1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pantera1 [17]
3 years ago
13

Help please Smart kids need it soon!

Biology
1 answer:
makkiz [27]3 years ago
6 0

Answer:

A. Prokaryote - no nucleus

B. Eukaryote - multicellular

C. Prokaryote - bacteria

D. Eukaryote - nucleus

E.  Both - Organism

F. Eukaryote - Insect

G. Prokaryote - Unicellular

H. Both - Cellular Respiration

Explanation:

You might be interested in
These organisms are prokaryotic cells, mostly<br> extremophiles.
lawyer [7]

Answer:

A extremeophile is a prokariyite,

Explanation:

6 0
3 years ago
In a protected grassland preserve, there are herds of antelope and zebra and a pride of fifteen lionesses with cubs. A conservat
vekshin1
This would cause the overpopulation in the grassland preserve. There would be too many antelopes and zebras that they would have to compete for survival. The food resources would run out for both species and cause a competition among every animal.
7 0
3 years ago
Read 2 more answers
PLEASE ANSWER!! WILL GIVE 20 POINTS!
sleet_krkn [62]

Answer:

.

Explanation:

6 0
3 years ago
Anwer the following:How hard the blood pushes on the inside of the blood vessels is called __________.The total amount of blood
Marina86 [1]

Answer:

How hard the blood pushes on the inside of the blood vessels is called Blood Pressure

The total amount of blood the heart pumps in one minute is called Cardiac Output

When blood vessels open wider during exercise, they are said to dilate

How many times your heart beats in one minute is called Heart Rate

The force that can put unhealthy tension on the heart as it is pumping is called Blood pressure

The amount of blood the heart pumps out in one beat is called Stroke volume.

Explanation:

All this concepts to the heart and cardiovascular system. It is important to know how heart is functioning to see how blood circulates.

3 0
3 years ago
Which statement most accurately describes the composition of elements dissolved in sea water?
pickupchik [31]
The answer would be the letter b
5 0
3 years ago
Read 2 more answers
Other questions:
  • Samantha???s job involves studying ecosystems and their components. Specifically, she deals with the population and growth of th
    5·1 answer
  • What were some of the biotic limiting factors in the deer’s ecosystem?
    10·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • What is the substitute of u in tRNA
    15·2 answers
  • Two scientists did the same experiment but arrived at different results. The scientists most likely
    11·2 answers
  • Which of the following examples best illustrates the process of evolution by natural selection?
    13·1 answer
  • Mid ocean ridges which contribute to the process of seafloor spreading Form as a result of
    7·1 answer
  • What do ecology and ecosystems have to do with disease?
    13·1 answer
  • If a rock was determined to be around 3.9 billion years old how much Potassium 40 would be left in that rock sample? (Percentage
    7·1 answer
  • Evolutionary divergence in directions of high phenotypic variance in the ostracode genus Poseidonamicus
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!