1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
3 years ago
14

Nuclear power plants produce large amounts of

Biology
1 answer:
Elanso [62]3 years ago
5 0

Answer:

Nuclear reactors are, fundamentally, large kettles, which are used to heat water to produce enormous amounts of low-carbon electricity. They come in different sizes and shapes, and can be powered by a variety of different fuels.

Explanation:

Hope this helps!! :))

You might be interested in
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
Bryophytes (non-vascular plants) ________. are more similar to ancestral green algae than are vascular plants can be included in
choli [55]
I think in this case Bryophytes are more similar to ancestral green algae than are vascular plants. These plants lack a vascular system for transporting water and minerals, Unlike angiosperms they do not produce flowers, fruits, or seeds. They also lack true leaves, roots, and . stems, They appear as small, green mats of vegetation found i damp habitats. Lack of vascular tissues means that these plants must remain in moist environments. 
4 0
3 years ago
Convert 9.75 millimeters to centimeters. centimeters
hoa [83]

Answer:

here,

10mm = 1cm

or, 1 mm=1/10 cm

or, 9.75mm=1/10×9.75cm

=0.975 ..........is the answer

<em>hope</em><em> </em><em>it</em><em> </em><em>helps</em><em>.</em><em>.</em>

6 0
4 years ago
HELP MEH PLZ
tigry1 [53]

Answer:

Macromolecule: polymer

Repeating units: monomer

Simple molecule: monomer

Covalent bonds: both

Hope this helps :)

Explanation:

3 0
4 years ago
Read 2 more answers
Do all fossils contain intact dna that can be sequenced.
lana [24]

Answer:

Yes,all fossils contain intact DNA that can be sequenced

Explanation:

4 0
2 years ago
Other questions:
  • If a child belonged to blood type o, he or she could not have been produced by which set of parents?
    10·1 answer
  • An organism is unicellular, contains chlorophyll, and has a flagellum. to which kingdom does this organism belong?
    6·1 answer
  • Whether during mitosis or meiosis, sister chromatids are held together by proteins referred to as cohesions. Such molecules must
    13·1 answer
  • How are the graphs of a body chemical controlled by negative feedback and a chemical controlled by positive feedback similar
    14·1 answer
  • What are the economic activities in the Amazon forest
    10·1 answer
  • What are the products of the chemical equation Na + Cl2----&gt; NaCl
    8·1 answer
  • Why does sound waves travel faster in salt water than in fresh water?
    9·2 answers
  • Wat could a dog living jow and a cat living thousands years ago have in common​
    6·2 answers
  • 18. What is another name for a complex carbohydrate?
    9·1 answer
  • Compare and contrast radiant energy and sound energy
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!