A neutron has no charge
<em>NEUT</em>RAL = NONE
well thats how I remember it anyway
SO ITS NUMBER 2
<span>Sputum membranes tests are used to test the lungs, trachea and bronchial canals for pathogens that can have an adverse affect on the lungs. These pathogens can cause infections that can have serious effects on your breathing and all over health.</span>
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer: The answers are:
1. The atmosphere interacts with the hydrosphere to redistribute water over the surface of Earth.
2. The atmosphere interacts with several Earth spheres, including the lithosphere.
3. Wind from the atmosphere creates ocean waves and currents.
Explanation: Just did it and Vote me as brainliest :)
true
im pretty sure plz mark brainliest
