1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miskamm [114]
3 years ago
15

Which best describes the process the respiratory system goes through to provide oxygen to the body?

Biology
1 answer:
ArbitrLikvidat [17]3 years ago
7 0

Answer:

The right side of your heart receives oxygen-poor blood from your veins and pumps it to your lungs, where it picks up oxygen and gets rid of carbon dioxide. The left side of your heart receives oxygen-rich blood from your lungs and pumps it through your arteries to the rest of your body.

Explanation:The right side of your heart receives oxygen-poor blood from your veins and pumps it to your lungs, where it picks up oxygen and gets rid of carbon dioxide. The left side of your heart receives oxygen-rich blood from your lungs and pumps it through your arteries to the rest of your body.

You might be interested in
In a far-off galaxy, an astronomer observes a moon orbiting a planet. The moon stays in orbit because of the planet’s gravity.
kobusy [5.1K]

Answer:Decreasing the distance between the moon and the planet

Explanation:

5 0
3 years ago
Read 2 more answers
the light reactions of photosynthesis supply the calvin cycle with; a) light energy.; b) co��� and atp.; c) h���o and nadph.; d)
Vesnalui [34]
The light reactions produce ATP and NADPH thet the Calvin cycle uses to convert CO2 into carbohydrate. The light reactions in the thylakoid membranes of the chloroplast,  and the reactions of the Calvin cycle take place in the stroma
4 0
3 years ago
What is a mature community?!
S_A_V [24]
Organisms that are well adapted to live together to in the same area over time.
3 0
3 years ago
What are the roles of hydrogen peroxide, oxygen, hydrogen, and catalase in the following chemical reaction
olga_2 [115]
Catalase is an enzyme, O2 and H2O are substrates, and H2O2 is a reactant.
Catalase is a substrate, O2 and H2O are substrates, and H2O2 is an enzyme.
Catalase is a substrate, O2 and H2O are products, and H2O2 is an enzyme.
<span>Catalase is an enzyme, O2 and H2O are products, and H2O2 is a substrate.</span>
7 0
3 years ago
Which process is governed by the autonomic nervous system?.
ankoles [38]

Answer:

<em>Involuntary </em><em>physiologic</em><em> </em><em>processes</em>

3 0
3 years ago
Other questions:
  • How could increasing the number of plants help you decrease error in the experiment? Check all possible reasons.
    9·2 answers
  • Phytoplankton populations are most abundant in the
    12·1 answer
  • What is the probability of choosing a "b" in the word probability?
    14·2 answers
  • The major light absorbing pigment in green plant photosynthesis is
    14·2 answers
  • How does the resolution of a specimen's image viewed under a compound light microscope compare to that of a scanning electron mi
    8·1 answer
  • The sl unit for measuring
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What are 2 factors that are used to describe climate?<br><br> xxx WILL GIVE BRAINLIEST xxx
    9·1 answer
  • This fossil trilobite and this living blue crab both have a limb structure called a biramous limb. What best explains why both s
    10·1 answer
  • What is the difference between cellular and internal respiration?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!