1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marusya05 [52]
3 years ago
15

DONT ANSWER IF YOU DONT KNOW

Biology
2 answers:
sp2606 [1]3 years ago
6 0
<span>1. Haploid
2. Diploid
3. Haploid
4. Diploid <span>
</span></span>
aliina [53]3 years ago
6 0
<span>Haploid

Diploid

Haploid

  Diploid <span>
</span></span>
You might be interested in
List one example of a falsifiable scientific hypothesis about oreo cookies.
snow_tiger [21]

Answer:

Oreo cookies are healthy for us

Explanation:

Look at the nutrition label

8 0
3 years ago
What is the complementary DNA of TACCGGATGCCAGATCAAATC?
Liono4ka [1.6K]

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary <u>DNA strand</u>.

7 0
3 years ago
The prime mover is Select one: a. a muscle working in opposition to another muscle. b. the end of the muscle where the action oc
RSB [31]

Answer:

 c. the muscle that does most of the movement.

Explanation:

The prime mover can also be called an agonist or the working muscles as it leads to the occurrence of movement by establish a specific usual range of movement in a joint via contraction.

It is the central muscle that particularly aid a specific movement or action.

Take for example, the triceps brachii is the major muscle that particularly aid movement during a triceps extension.

8 0
3 years ago
Give two examples that illustrate interactions that occur between the abiotic and biotic parts of this ecosystems....
romanna [79]

Answer:

A Elephant eats some grass

A lion rolls in the sand

Explanation:

Elephants and lions are biotic(living), and grass and sand are abiotic (nonliving) and those are two interactions

4 0
4 years ago
Which of the following BEST explains the timing of the classical pathway of complement fixation,relative to the other pathways o
SOVA2 [1]

Answer:

<h2>A</h2>

Explanation:

1. There are 3 pathways of complement activation:

i) the classical pathway;

ii) the MB-lectin pathway; and

iii) the alternative pathway.

2. The classical complement pathway;  for activation, it requires antigen(Ag) antibody(Ab) complexes.

3. While the other pathways can be activated by various ways.

as here,  No target for C1qrs exists on the surface of the pathogen in the earliest stages of the response to it.

8 0
4 years ago
Other questions:
  • Which best describes a difference between transcription and DNA replication??
    8·2 answers
  • Longshore drift occurs when
    15·2 answers
  • A social-conflict analysis suggests that schooling in the united states developed in the late nineteenth century because that wa
    6·1 answer
  • Which is a function of nucleic acids
    14·1 answer
  • ¿Qué estructura de la célula procariota, permite el paso del plásmido de una bacteria a otra facilitando la conjugación?
    9·1 answer
  • The structure that regulates what enters and leaves the celt is called the
    14·2 answers
  • When a substances like sugar, salt or lemon juice dissolve into a liquid and appears to "disappear", it is no longer present in
    6·1 answer
  • An experiment is designed to compare the effects of glucose and sucrose on the osmoticpotential of a model cell. Two dialysis ba
    7·1 answer
  • A person sprints across a football field to make the touchdown. The person’s muscles use up most of the oxygen in the blood to a
    6·1 answer
  • 4. What type of molecules can move down the concentration gradient and why
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!