1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lapo4ka [179]
3 years ago
10

What is the complementary DNA of TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Liono4ka [1.6K]3 years ago
7 0

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary <u>DNA strand</u>.

You might be interested in
Fill in the blank
Anarel [89]

Answer:

hydrogen

helium

plasma

auroras

magnetic

White dwarfs are lower on the scale of luminosity varying from .001 to 1, compared with the brighter luminosity of super giants that are measured at 10,000 and above. White dwarfs are in the blue to white stellar temperature, and super giants are measured as white on the stellar temperature.

Explanation:

8 0
4 years ago
Read 2 more answers
The correct order of phases of the cell cycle is?
finlep [7]
Interphase, prophase, metaphase, anaphase, telophase,
3 0
3 years ago
What is the typical number of parathyroid glands?
OleMash [197]
The typical number of parathyroid gland is four
6 0
4 years ago
What do you think would happen if a trial of the experiment was done with frozen liver and potato?
Lerok [7]

Explanation:

They would react the same as with the vinegar and hydrogen peroxide at room temperature. They would react the same as with just the hydrogen peroxide.

4 0
3 years ago
A ___ is a species whose population is at risk of extinction.
konstantin123 [22]
An endangered species.

3 0
4 years ago
Read 2 more answers
Other questions:
  • Conservation biologists are most interested in which three evolutionary mechanisms?
    14·2 answers
  • What is "synthesized" in the activation-synthesis model of dreaming?
    14·2 answers
  • Describes an organism that can only exist only as a group of cells
    5·1 answer
  • A nurse is delivering 3 l/min oxygen to a patient via nasal cannula. what percentage of delivered oxygen is the patient receivin
    10·1 answer
  • Is the sustainability of the atmosphere affected by the melting of the arctic ice cap
    8·1 answer
  • Photoautotroph"" means: Select one: A. light self-grower. B. light organic feeder. C. light self-feeder. D. chemical inorganic f
    5·1 answer
  • Cellular respiration requirements<br>​
    8·1 answer
  • 1. )Which of the following would be classified as an acute disease condition?
    10·1 answer
  • Can someone help me please ?
    14·1 answer
  • What happens when a phase in the cell cycle does something incorrectly / doesn't do its required tasks, what happens to the cell
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!