1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lapo4ka [179]
3 years ago
10

What is the complementary DNA of TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Liono4ka [1.6K]3 years ago
7 0

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary <u>DNA strand</u>.

You might be interested in
What gender of offspring are most often affected by sextinked inheritance?-What gender-are-usmally-carriers-of the trait?
katovenus [111]

Answer:

female, female

Explanation:

this is because sex-linked characters are normally borne in the X-chromosome

8 0
3 years ago
Chromosomes other than sex chromosomes are known as _____. autosomes alleles genes proteins
lianna [129]
The answer is autosomes.

<span>In a human diploid somatic cell (2n), there are 22 chromosomes present in two copies and 1 pair of sex chromosomes. This means there are 23 pairs of chromosomes - 22 pairs of autosomes and 1 pair of sex chromosomes. There are in total 46 chromosomes (23 pairs in 2 copies: 23 × 2 = 46).</span>

8 0
3 years ago
Read 2 more answers
The stigma produces a sugary substance.<br> true <br> false <br><br> help please thanks : )
Brilliant_brown [7]
The answer is A)true
4 0
4 years ago
A woman has delivered twins. The first twin was stillborn, and the second is in the intensive care nursery and is recovering qui
Archy [21]
<h2>Therapeutic response</h2>

Explanation:

Therapeutic response can be explained as:

The nurse should recognize the woman's grief and its significance

Asking her about plans for another baby is denying the loss of the other infant

Pointing out the health of another baby will disturb her feelings, repeatedly stating that the the woman has lost a twin will harm her emotionally and mentally

Here, woman needs psychosocial integrity which will help her heal faster and this is the basic health need she requires at this particular period of time

7 0
4 years ago
13. Write a flow chart for Aerobic respiration starting from Glucose to
Nata [24]

Answer:

<em>Aerobic respiration occurs in the steps:</em>

Glycolysis--> respiration-->  ETC

<em>(see images for flow chart)</em>

<em />

Explanation:

The mitochondria inside the cell's cytoplasm is an organelle. It consists of a gel-like material comprising an outer membrane, an inner membrane, and a matrix. In mitochondria, cells break down sugars in the form of glucose during aerobic respiration, in the presence of oxygen...

This occurs via glycolysis, the Kreb's cyle, and the electron transport chain (ETC)

C6H12O6 (glucose) + 6 O2 → 6 CO2 + 6 H2O + ≅38 ATP

   glucose + oxygen            →  carbon dioxide+ water+ energy

5 0
3 years ago
Other questions:
  • The marine iguanas are the only marine lizard in the world and they live in the (2 points)
    14·1 answer
  • Discuss two ways that all cells are alike
    6·2 answers
  • Which is not part of an organisms environment
    8·1 answer
  • A population of plants comes in two flower colors: blue and white. crossing two blue-flowered plants produces mostly blue-flower
    8·1 answer
  • The surface area/volume ratio is an important factor for one celled organisms. All the parts of a cell go into making its volume
    8·2 answers
  • Whose system of classifying and naming organisms is still in use today?
    6·1 answer
  • Which is not true about cancer cells
    6·2 answers
  • Kyle is extremely manipulative. He can look anyone in the eye and lie convincingly. His deceit often endangers the safety and we
    11·1 answer
  • Can you help me Did you brainless any science
    5·2 answers
  • Need help with this.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!