1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scrat [10]
3 years ago
5

Given the DNA sequence GCCAGGTAAT, determine the correct complementary DNA strand from the choices below:

Biology
2 answers:
charle [14.2K]3 years ago
8 0

Answer:

C

Explanation:

This is because G and C are opposites of each other, same goes for A and T. This works for DNA.

ICE Princess25 [194]3 years ago
3 0
In dna G-C and A-T. always, unless it’s MRNA.
CGGTCCATTA. your answer is C.
You might be interested in
Which is a. Source of energy for earths living thinks
Solnce55 [7]
Cows because theyer  and manewer contains methane witch can power generators
4 0
3 years ago
Which kingdom is composed of eukaryotes which are mostly unicellular that can be heterotrophs or autotrophs?
kodGreya [7K]
Im  like  99%  sure  its  kingdom portista
8 0
3 years ago
Read 2 more answers
Mutations in the DNA cause different _______ I to be made.​
nirvana33 [79]

Answer:

interested in DNA changes in the cells that produce the next generation.

3 0
3 years ago
The process of photosynthesis produces __________ and __________.
ANEK [815]
Sugar and oxygen are the end products of photosynthesis
8 0
3 years ago
How do we know that Rupa love the cow ​
Savatey [412]

Kurma Rupa was unique, he claims. He was devoted to the Lord's cattle and, by himself, raised awareness of the issue among a great number of people.

<h3>Kurma Rupa</h3>
  • On June 28th, at the age of 67, Kurma Rupa Das, the director of the cow protection group Care for Cows and a beloved gurukula instructor, passed away in Krishna's sacred city of Vrindavan, India, from metastasized stomach cancer.
  • He was surrounded by Brijabasis singing Krishna kirtan, his beloved cows, and other devotee pals.
  • Kurma Rupa was raised in New York and was born to Mexican parents. He was drafted during the Vietnam War at the age of 21.
  • Kurma Rupa taught youngsters from all over the world for many years at the Bhaktivedanta Swami International Gurukula.
  • He was compassionate and understanding, and he is known for going above and beyond to support the kids in their studies and other pursuits.

To learn more about Kurma Rupa refer:

brainly.com/question/11184843

#SPJ9

3 0
2 years ago
Other questions:
  • Proteins are compounds formed in the cells of plants and animals. Which element is included in every protein molecule?
    10·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Which of the following is an example of an antigen that might be recognized by the immune system of an individual?
    7·1 answer
  • What do regulatory T cells do?
    10·1 answer
  • The sequence of ____ carries the genetic information of an organism.
    9·1 answer
  • The carrier molecules of the electron transport system are located in the
    13·2 answers
  • Sometimes we call "clean energy"<br> *<br> A) Fossil fuels B) Petroleum C) green energy
    12·1 answer
  • Which of the following statements about mitochondrial chemiosmosis is NOT true?
    14·1 answer
  • What would happen if temperature of the sun increased by a billion degrees?
    14·2 answers
  • The celery and potatoes in the salt water wilted and got soft because there was less water outside the cells. The water left to
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!