1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Georgia [21]
3 years ago
7

The conserved residues in the hemoglobins and myoglobins include the ________ proximal and distal to the heme iron.

Biology
1 answer:
Ilya [14]3 years ago
6 0

Answer:

Histidine

Explanation:

A heme group is a prosthetic group composed of a protoporphyrin ring and an iron (Fe) atom that binds to oxygen (O2) in hemoglobin and myoglobin. Hemoglobin (Hb) is a protein in red blood cells (erythrocytes) that carries oxygen from the lungs to the tissues, which is composed of four polypeptide chains, each with a heme group. Moreover, myoglobin is a monomeric protein located mainly in the muscles, which contains one heme group, being thus similar to hemoglobin monomers. The proximal and distal are evolutionarily conserved amino acid (histidine) residues whose names (proximal and distal) refer to their position with the iron (Fe) atom in the heme group. The proximal histidine connects the heme group with the proteins (either in monomeric myoglobin or in one subunit of Hb), whereas distal histidine contributes to stabilize these proteins while carrying O2.

You might be interested in
Both algae and the fungus are benefited from their relationship in a lichen. This relationship is one of
AlexFokin [52]

Answer:

mutualistic

Explanation:

both organisms get something out of it

4 0
3 years ago
1) The density of a substance is the ratio of its mass to its volume. The formula for density is: D = mass/volume. If the densit
Agata [3.3K]
Yes d =the mass value and
6 0
3 years ago
Vaccination has been shown to cause autism.Select one:TrueFalse
Mariulka [41]

As we know vaccines have been a very controversial topic, and one of them is autism, even when this has been proved false and the original paper where it was published the study retracted, there still a number of people who argue that this is true, even when evidence in favor of vaccine safety is overwelming. Therefore the correct answer is false.

4 0
1 year ago
Barnacles live on wheels. whales carry their barnacles around, which helps the barnacles feed. the whales are unaffected. this i
MArishka [77]
Commensalism- where both organism isn’t helped or harmed
3 0
3 years ago
The harp seal lives on the polar ice sheets. Which adaptation makes it best suited for this environment?
Molodets [167]

they have adapted by regulating their body temperature in different ways.

5 0
3 years ago
Other questions:
  • How is a raft different from a typical ecosystem when considering carrying capacity?
    7·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • A factor which could increase preload and how would stroke volume be affected
    13·1 answer
  • Skin cancer is to exposure to the UV radiation as
    7·2 answers
  • What was the function and importance of S-necked flasks in Louis Pasteur’s experiments in disproving spontaneous generation?
    9·1 answer
  • __________ are secreted by cells infected with viruses, alerting neighboring cells and protecting them from becoming infected.
    10·1 answer
  • Which of these disorders, in which blood does not clot normally, can a technician diagnose through genetic testing? A. malaria B
    8·1 answer
  • Why does cellular respiration need photosynthesis?
    13·1 answer
  • What is the major structural difference between starch and glycogen?
    13·1 answer
  • Messages are carried from the eyes to the brain by Question 5 options: nerves muscle light blood vessels.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!