1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
12

What would be the best explanation for why myelinated fibers conduct signals faster than unmyelinated fibers?

Biology
1 answer:
Sliva [168]3 years ago
6 0

Answer: The diffusion of ions along the axoplasm is faster,in myelinated compare to unmyelinated,

Neurons are the structural and functioning units of nervous system.They are the vehicles for transmission of impulses as electrical signals from one part of the cells,and from one part of the body to another.

The basic structural components of a typical neuron are the cellbody, the axon, and the dendrites.

Based on structure neurons are classified as myelinated and unmyelinated.This is based on the the surrounding layer of myelin sheath around the axon. The myelin provides the insulating layer for the axon.And ensures fast movement of impluses.

In myelinated neurons the myelin sheath are interrupted at intervals by gaps along the length of the axon called Nodes of Ranvier. These gaps contains more Na-K channels for influx and out-flux of K and Na+ ions for transmission of impulses.

The cytoplasm of axon is called axoplasm,Since this is surrounded by myelin sheath which contains Na-K+ channels,The rate of diffusion of ions along  these channels is faster for depolarization to take place than in unmyelinated neurons. Inaddtion as these ions  diffusion increases,its jump faster at the nodes of Ranvier (saltatory conduction) to the next axoplasm which further speed up the rate of transmission.

Unmyeinated lacks myelin sheath,therefore the exchange and  the rate of diffusion of ions along the axons is low.

Explnation:

You might be interested in
What is homeostasis? What is an example of homeostasis?
weeeeeb [17]

Answer: the tendency toward a relatively stable equilibrium between interdependent elements, especially as maintained by physiological processes.

Explanation:  one of the most familiar examples of homeostasis Body temperature control in humans

plz mark brianliest

4 0
4 years ago
When a protein is treated with a reducing agent such as 2-mercaptoethanol it becomes denatured. The interactions stabilizing the
Andreas93 [3]

Answer:

Disulfide linkage/bond

Explanation:

The tertiary and quarternary structure of the protein is stabilized by Disulfide linkage which is formed between two thiol groups in the protein. 2-mercaptoethanol is a reducing agent that breaks this disulfide bond.  

A protein becomes denature when it loses its native configuration and becomes inactive. So as 2-mercaptoethanol breaks disulfide bond in protein it looses its native configuration and becomes denatured. 2-mercaptoethanol  is used in SDS-PAGE to separate protein subunits. Therefore the correct answer is Disulfide linkage/bond.

8 0
3 years ago
If the fossil of a seashell is found buried in a desert region, what might you learn from that fossil?
Luba_88 [7]

Answer:

Answer: D!

Explanation:

6 0
3 years ago
Read 2 more answers
Hurricanes and severe storms can lead to flooding. Homes are damaged from rising water. The water can enter the home through bro
Deffense [45]
The answer to this problem is c
7 0
3 years ago
Identify the organ of the digestive system.
Tems11 [23]
I think the answer is b because the small intestine has all three of the stomach, large intestine and liver.
4 0
3 years ago
Other questions:
  • anomaly occurs when the tunica vaginalis completely surrounds the testis, epididymis, and distal spermatic cord, allowing them t
    7·1 answer
  • The sugar __________ is found only in milk and milk products.
    15·1 answer
  • Which of the following is generally true of an X-linked recessive pedigree?
    9·1 answer
  • scientists believe that the early universe started with only two elements, hydrogen and helium
    7·1 answer
  • All atoms of the same element contain the same number of
    11·1 answer
  • Which of the following describes a factor that would limit the carrying capacity of a population within a particular ecosystem?
    10·2 answers
  • Glucose is a molecule that can move across the cell membrane. If the concentration of glucose is higher outside the cell then wh
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Models can be used to describe
    5·2 answers
  • What are the two most common alkaline earth metals?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!