1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KonstantinChe [14]
3 years ago
11

Which of these processes are driven by energy from Earth's interior?

Biology
1 answer:
Angelina_Jolie [31]3 years ago
4 0
I believe it’s B but I’m not sure sorry
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
True or false: light independent reactions utilize pigments, involve the electron transport system, and are relatively fast reac
VLD [36.1K]

true i think this is right

7 0
3 years ago
A system to maintain homeostasis must have at least four parts that function together. name these abd bruefly explain what each
hoa [83]
1.Nucleic acids:Stores and transfers info
2.Carbohydrates:Store energy, provide fuel, and build structure in body, main source of energy, structure of plant cell wall
3.Lipid:Insulator and stores fat and energy
4.Protein:Provide structural support, transport, enzymes, movement, defense
5 0
3 years ago
Can someone please help me I’m stuck on this question!!
Lina20 [59]

Answer:I think that answer is b

Explanation:

4 0
3 years ago
The foxglove plant, seen in the illustration, produces very toxic chemicals that can cause serious illness and death in any orga
s2008m [1.1K]

There is no answer ,you wrote the answers with the question

4 0
4 years ago
Read 2 more answers
Other questions:
  • Which component of our galaxy contains only a small amount of interstellar medium? a.disk b.center c.bulge d.halo
    10·2 answers
  • Give two reasons why the chromosome number can be used to characterise a species.
    13·1 answer
  • 2 Points
    13·1 answer
  • In part A, you analyzed genes that contribute to two diseases. (cystic fibrosis and muscular dystrophy) How can scientists use t
    9·1 answer
  • What is the definition of autotroph. Please keep it simple as possible.
    6·1 answer
  • How is energy released in organic compounds?
    15·2 answers
  • Mitochondria are unique organelles in several ways. They contain a specific genome that allows them to code for their own protei
    11·1 answer
  • Chemical substances in plants that act as internal stimuli are called
    15·1 answer
  • describe the water cycle here on Earth and explain how it demonstrates the law of conservation of matter.
    15·1 answer
  • The oxygen-carrying component in red blood cells is _____________________________.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!