A single random allele from each pair of parent alleles will be passed on to the gamete.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
But what does “waxing and waning gibbous” mean? Rob says crescent is when you can see less than half of the moon illuminated. “Gibbous, you attach that to either waxing or waning when you see more than half of the moon illuminated,” he said. Waxing means it's getting bigger while waning means it's getting smaller.
Answer:
16. Carbohydrates
17. Lipids
18. Carbohydrates
19. Carbohydrates
20. Lipids
21. Lipids
22. Carbohydrates
23. Lipids
Explanation:
Carbohydrates are organic molecules composed of carbon, hydrogen and oxygen. Carbohydrates can be classified into three types: monosaccharides (e.g. glucose), disaccharides (e.g., lactose), and polysaccharides (e.g., starch). Cellulose is a carbohydrate where many glucose rings chain together, while chitin is a polysaccharide consisting of chains of modified glucose molecules.
Lipids represent a diverse group of organic molecules that include, among others, fats, waxes, oils, hormones, etc. Lipids play a role by insulating (and protecting) the body. For example, there is a layer of fats beneath the skin which enables to maintain body temperature relatively constant. In animals, lipids constitute about 50% of the mass of cell membranes. These membrane lipids are mainly phospholipids, glycolipids and cholesterol. There are hormones that derive from lipids such as steroid hormones, which derive from cholesterol. Some examples of steroid hormones are testosterone, estrogen and cortisol.
