1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alina [70]
3 years ago
5

Please help me with this question:)

Biology
2 answers:
Elina [12.6K]3 years ago
7 0

Answer:

C: Prokaryote

Explanation:

This is not an animal or plant cell

WINSTONCH [101]3 years ago
4 0

Answer:

Pokaryote is the right answer.

You might be interested in
A bacterial cell can live independently of other cells and does not have a membrane surrounding its nucleus. Which set of terms
Dima020 [189]
The answer to your question would have to be C
3 0
4 years ago
Stronger earthquakes closer to the surface and gas<br> explosions
Nana76 [90]

Answer:

Aftershocks are sometimes just as hazardous as the main quake itself. In fact, aftershocks may be so strong that they're stronger than the main quake. ... While foreshocks occur around the same time of the main quake, aftershocks may not occur until days or weeks later! The point at the Earth's surface directly above the focus is called the epicenter of the earthquake. At the epicenter, the strongest shaking occurs during an earthquake.

Hope this helps, have a great day/night, and stay safe!

4 0
3 years ago
Which of the following best describes the flow of energy in photosynthesis?
Strike441 [17]

Answer:

Energy from the sun is transformed into stored chemical energy if the form of glucose.

Explanation:

Glucose is the food of plants

6 0
3 years ago
What is A stem cell is
polet [3.4K]

<em>by definition- a stem cell is an undifferentiated cell of a multi-cellular organism which is capable of giving rise to indefinitely more cells of the same type, and from which certain other kinds of cell arise by differentiation.</em>

an example

Stem cells have the potential to be whatever they want to be. Stem cells are able to develop into many different types of cells and can repair your body.

there are two types

adult stem cells and embryonic stem cells

6 0
4 years ago
How does the density of ice compare to that of liquid water and why is that property important to aquatic organisms
Amanda [17]

The density of ice is less than water - that's why it floats on water. I think this property is unique in liquids.

If ice was equal or heavier density than water then the oceans would be solid except for near the surface, which would be very bad for aquatic life!!

3 0
3 years ago
Read 2 more answers
Other questions:
  • The cardiovascular system is composed of which of the following?
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Why did the earth not have oceans
    15·1 answer
  • Help me in biology please...
    8·2 answers
  • A 41-year-old pregnant female miscarries in her first trimester. A karyotype shows that the fetus had 45 chromosomes. Which of t
    15·1 answer
  • When does recycling happen in the mineral resource cycle?
    15·2 answers
  • If your observations do not support your hypothesis, what<br> should you<br> you do?
    13·1 answer
  • Plz help me well mark brainliest if you are correct!
    14·1 answer
  • What does it mean when the pH increases or decreases​
    12·1 answer
  • Water in the blood helps carry nutrients and gases required foe survival througout the body. Which characteristics of water allo
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!