1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guajiro [1.7K]
2 years ago
15

What’s the function of liver in digestive system?

Biology
2 answers:
uysha [10]2 years ago
7 0

Answer:permite transportar desechos y descomponer grasas en el intestino delgado durante la digestión. Fabrica ciertas proteínas para el plasma sanguíneo. Produce colesterol y proteínas especiales que permiten enviar grasas por todo el cuerpo.

Explanation:

Veronika [31]2 years ago
4 0
The liver makes bile
You might be interested in
What is an acid in terms of pH
igor_vitrenko [27]
On the pH scale 7 is a neutral. Anything below 7 is acidic and anything above 7 is a base.
5 0
3 years ago
Which characteristic sets streams and rivers apart?
nikdorinn [45]

size hence streams  are little and rivers are bigger than streams because a stream connects between two or more rivers

mark brainliest please   :)

3 0
3 years ago
Why does butterflies taste with their feet?
scZoUnD [109]
Butterflies taste with their feet to tell on which plans they lay their eggs on. Plus, they have a taste sensors on their feet. Hope I helped you. xoxo :)
6 0
3 years ago
Scientists were monitoring a meteor headed toward Earth. It moved off course, but some pieces of rock entered the Earth’s atmosp
abruzzese [7]
<h2>Answer:</h2>

Mesosphere

<h2>Explanation:</h2>

The atmospheric layer that protects the Earth against danger of the rocks is the mesosphere. This layer is above the stratosphere. The temperature drops in this layer to about -100 degrees Celsius. This is the coldest region of the atmosphere. The mesosphere burns up most meteors and asteroids before they are able to reach the earth's surface. It becomes cold enough to freeze water vapor in its atmosphere into ice clouds.

3 0
3 years ago
Read 2 more answers
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
Other questions:
  • Where are the instructions for cell differentiation located?
    10·2 answers
  • Help fast worth 10points Which is NOT a benefit of using a space probe.
    15·1 answer
  • What is Human resources management
    8·1 answer
  • How many electrons are in a nucleus
    6·1 answer
  • Sally has curly hair, this is an example of her ____
    13·2 answers
  • Why do temperatures differ between air, land, and water? <br> (science btw)
    12·1 answer
  • Witch best describes the function of a chloroplast?
    14·2 answers
  • How might the increase of volcanic eruptions affect Earth?
    11·1 answer
  • Which of the following structures in a plant cell is responsible for the production of food​
    13·1 answer
  • Which is the correct associaticm?: polymers combine to form monomers glucose combines to form proteins FIRST ਜ monomers combine
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!