On the pH scale 7 is a neutral. Anything below 7 is acidic and anything above 7 is a base.
size hence streams are little and rivers are bigger than streams because a stream connects between two or more rivers
mark brainliest please :)
Butterflies taste with their feet to tell on which plans they lay their eggs on. Plus, they have a taste sensors on their feet. Hope I helped you. xoxo :)
<h2>Answer:</h2>
Mesosphere
<h2>Explanation:</h2>
The atmospheric layer that protects the Earth against danger of the rocks is the mesosphere. This layer is above the stratosphere. The temperature drops in this layer to about -100 degrees Celsius. This is the coldest region of the atmosphere. The mesosphere burns up most meteors and asteroids before they are able to reach the earth's surface. It becomes cold enough to freeze water vapor in its atmosphere into ice clouds.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand