Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
False the bear is claiming the area as it's territory
Answer:
Eurasian and North American
Explanation:
Answer:
Explanation:
bacteria with No Plasmid -----------------will grow ONLY in medium without ampicillin.
"nonrecombinant gene, recombinant plasmid with vgp gene,", recombinant plasmid but no vgp gene-----------------------will grow in both media".
it means Plasmid have ampicillin resistance gene. So if we use medium with ampicillin so it will allow the growth of only those bacterai which have transformed plasmid (containing amp resistance gene).
so having gene or not, recombinant or recombinant dosnt matter, all the other s will grow in both type of medium as far as plasmid is transformed in to it.