1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Varvara68 [4.7K]
3 years ago
9

10 points for correct answer (Dont put a random answer or else you will get reported)

Biology
2 answers:
devlian [24]3 years ago
6 0

Answer:

50%

Explanation:

let me know if im right tho

Rudik [331]3 years ago
3 0

Answer:

50%

Explanation:

based on the punnett square, 50% will be pink, with the remaining 50% being white

You might be interested in
MULTIPLE CHOICE
masya89 [10]

Answer:

6 is D

7 is C

8 is D

9 is C

10 is B

Explanation:

3 0
3 years ago
Summarize how biotic potential and competition for biotic and non living things are connected
Lynna [10]

Both abiotic and biotic factors determine both where an organism can live and how much a population can grow.  A limiting factor is a factor that restricts the size of a population from reaching its full potential

The amount of food & water in a habitat is an example of a limiting factor. Other factors include geographical space, predation, climate, competition (for prey, food, mates) etc. An example of a limiting factor is sunlight in the rainforest, where growth is limited to all plants in the understory unless more light becomes available. Or perhaps in a deciduous forest, there are not enough rabbits to support the growth of more foxes. All species within an ecosystem will experience some kind of limiting factors to prevent continuous and exponential growth. (Even humans) Environmental changes (i.e drought, famine, human destruction) results in decreased rates of physiological processes, lowering the potential for survival, growth, or reproduction. Species will undergo Acclimatization to adjust to the new limiting factors through  changing their behavior or physiology.

5 0
3 years ago
Most of the energy used by life on earth comes from which
Sergio [31]
The sun.....................
8 0
3 years ago
A friend of yours is trying to get pregnant. she is asking you on which day(s) during her menstrual cycle would she have the gre
viva [34]
She has the greatest chances of conceiving about halfway through her menstrual cycle, or at the 14 day mark.
5 0
3 years ago
Based on the diagram below, which part of an atom has the greatest mass?
Juli2301 [7.4K]
The nucleus will have the greatest mass. Among the 3 kinds of subatomic particles, electrons are the lightest (by several orders of magnitude), protons and neutrons are much closer is magnitude, though neutrons are slightly heavier. However, in the diagram, the nucleus contains both the neutrons and the protons, so its combined mass would be heavier than either the neutrons alone or the protons alone.
7 0
3 years ago
Read 2 more answers
Other questions:
  • How do you use topographical maps and satellite views to identify land and erosional features and predict how these features may
    11·1 answer
  • Which is an example of a eukaryote? A) Euglena B) AIDS virus C) lactobacillus D) cyanobacteria
    5·2 answers
  • Based on the table, which domains contain only one cell type?
    5·1 answer
  • Dna and protein material in a loose and diffuse state is called
    7·2 answers
  • You notice a buildup of dark clouds and shifting winds. what is likely?
    13·2 answers
  • Which data type, morphological or molecular, will allow you to create a more accurate cladogram?
    13·2 answers
  • How does water pollution can harm humans ​
    5·1 answer
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • Which is the BEST description for the process of photosynthesis?
    6·1 answer
  • What other traits in humans do you think follow the characteristics of simple inherited traits?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!