1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vitek1552 [10]
2 years ago
5

This key element is an essential part of amino acids (proteins). Identify this element. How does this element move through the s

pheres of Earth? What is this process called?​
Biology
1 answer:
JulijaS [17]2 years ago
7 0

Answer:

I believe it might be carbon cycle? I'm not 100% sure

You might be interested in
In tomatoes, two alleles of onegene determines whether the plant has purple (P) or green (G) stems, and a separate, independent
Degger [83]

Answer:

The correct answer will be G/G ; P/p x g/g ; P/p

Explanation:

Let G be the dominant allele for stem color and g be the recessive allele for stem color. Let P be the dominant allele for leave shape and p be the recessive allele for leave shape.

5 0
3 years ago
Henry went on a field trip to a national park. He not only observed the aquatic life in the pond, but also the trees, vegetation
Mariulka [41]

Answer:

Henry observed <u>ecological diversity</u>.

Explanation:

Ecological diversity can be described as the variations which are present among different ecosystems and how these variations impact the life on Earth. The differences present in the aquatic and terrestrial ecosystems are defined by the ecological diversity.

As Henry is observing the differences in the aquatic life as well as the terrestrial life, hence he is studying ecological diversity.

Ecological diversity is a type of biodiversity i.e diversity of all the living components of ecosystems.

7 0
3 years ago
Fossils help us reconstruct plant and animal life in the past as well as their evolutionary processes, which can be either slow
NNADVOKAT [17]

Answer:

True

Explanation:

When we talk about fossils, we are referring to the remains of organisms that had once lived. These are traces of the organisms that existed in the distant past.

These fossil records help us to reconstruct plant and animal life in the past as well as their evolutionary processes, which can be either slow or rapid.

Fossil records reveal extinct species and help us to make sense of the evolutionary processes on earth.

4 0
2 years ago
What did humans in England do to change the tree trunks in mid 1800's?
Katarina [22]

Answer:

Scientists have discovered the specific mutation that famously turned moths black during the Industrial Revolution. In an iconic evolutionary case study, a black form of the peppered moth rapidly took over in industrial parts of the UK during the 1800s, as soot blackened the tree trunks and walls of its habitat

Explanation:

5 0
3 years ago
Read 2 more answers
Lipid is one of the major classes of biomolecules needed by the body. The body breaks down the lipids that we consume to create
Darina [25.2K]
So the breakdown of lipids actually starts in the mouth. Your saliva has this little enzyme called lingual lipase, which breaks down these fats into something called diglycerides. These diglycyerides then make there way to the intestines, where they stimulate the pancreas to release lipase (another fat breaking enzyme!) and the pancreas to release bile. The bile and pancreatic juices both work together to break these diglycerides into fatty acids. It’s helpful to know some of the root words. Glycerol- the framework to which the fatty acids stick. Glyceride- think of this guy as several fatty acids stuck to a glycerol. Lipids- think fats, and their derivatives (our glyceride friends.) tri/di/mono- these are just number prefixes! Lipids are one glycerol molecule, and then either one, two, or three fatty acids attached, which is where you get mono(1)/di(2)/tri(3)glyceride from. I know this was long, but hopefully it helps!
5 0
3 years ago
Other questions:
  • During periods of less light, many plants lose their leaves. Does this mean that photosynthesis stops?
    7·1 answer
  • If a twisted ladder is used as a model of DNA, which parts of a DNA molecule correspond to the sides of the ladder?
    7·1 answer
  • Nalah labels ten rats with the numbers 1 through 10. Then, she records how long it takes each rat to run through a maze. She fin
    9·2 answers
  • if a strong odour smell continuously for sometime,the sensation of smell of that substance weaken...why?
    8·2 answers
  • the maximum displacement of a particle,within a wave,above or below its equilibrium position, is called
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • CU.
    14·1 answer
  • How long can you leave uncooked potatoes in water?
    6·1 answer
  • An ELISA test can be used to look for a particular infection in a patient in 2 ways: an antigen 1 point
    7·1 answer
  • A type of frog is introduced to a new environment, and it has no predators there. What is likely to happen?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!