1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mr Goodwill [35]
3 years ago
12

Turner syndrome occurs in females who instead of having two X chromosomes have either only one X chromosome or a fragmented X ch

romosome. Klinefelter syndrome occurs in males who have multiple X chromosomes. Consider the karyotype.
A karyotype indicates that a male has multiple x chromosomes.

Which individual is shown in the karyotype?
male with Turner syndrome
male with Klinefelter syndrome
female with Turner syndrome
female with Klinefelter syndrome
Biology
2 answers:
luda_lava [24]3 years ago
7 0

Answer:

male with Klinefelter syndrome

Explanation:

for an individual to be considered male he needs  to have at least one Y chromosome

usually an individual with Klinefelter syndrome has two X chromosomes instead of 1 and 1 Y chromosome(XXY) but the karyotype can also be XXXY

matrenka [14]3 years ago
6 0

Answer:

its B

Explanation:

it belongs to a man with Klinefelter syndrome

You might be interested in
How is the life cycle of the jellyfish different from the sponge?​
Annette [7]
Sponges have specialized cells and an endoskeleton, but they lack tissues and body symmetry. ... They include jellyfish and corals, both of which have radial symmetry. All cnidarians have nematocysts, and many are bioluminescent. They may exist in medusa and/or polyp form.
3 0
3 years ago
SOMEONE HELP MEEEEEEEEE PLEASEE
ValentinkaMS [17]

Answer:

i dont know but you pfp bad ;/

Explanation:

3 0
3 years ago
What conclusions can you draw about the relationship between light intensity and the rate of photosynthesis?
Studentka2010 [4]
The more intense the light is, the faster the rate of photosynthesis will occur
8 0
3 years ago
How many hydrogen atoms are in a molecule of water?
USPshnik [31]
There are two hydrogen atoms in a molecule of water.
8 0
3 years ago
Read 2 more answers
An individual has a genetic disorder in which their cell is not forming the correct protein structure for the cell membrane to a
Andru [333]

Answer:

The type of regulation of gene expression that would have the greatest chance of success is Posttranslational control (E).

Explanation:

The defect is found on the structure of the protein, this means that the process of formation of the protein and the codons responsible for each amino acid in the protein is in correct order, this set the transcriptional and translational process aside as being correct.

Therefore, the problem lies in the formation of secondary or tertiary structure of the protein which requires a good number of proteins also, wherein lies tha main problem in the cell membrane protein. Thus the regulation of the posttranslational process and correction of the proteins needed at this stage will give the best chance of success.

3 0
3 years ago
Other questions:
  • true or false : determining the source and motive of an ad for a health product will helph you decide whether the ad is a reliab
    9·1 answer
  • Twind is considered to be an abiotic factor because it.?
    12·1 answer
  • DNA provides the blueprint for the synthesis of proteins. A _______ is a segment of DNA that codes for one particular protein.
    8·1 answer
  • Glucokinase has a Km value of 10.0 mM, whereas hexokinase has a Km value of 0.1 mM. This is consistent with which of the followi
    8·1 answer
  • What do beetles eat.
    12·1 answer
  • When does the segregation of alleles occur?
    14·1 answer
  • Based on the weathering patterns, guess the rock type shown in each photo.
    7·1 answer
  • Why do you think that root hairs are produced only on the parts of the root system that have stopped growing?
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Plzz helpp! will give brainliest!<br><br> In your own words, what is the definition of the Universe?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!