If a blood exposure occurs while providing a consumer service, the practitioner must disinfect all equipment, instruments, and surfaces with a bleach solution or a disinfectant that has been registered by the EPA that is bactericidal, virucidal, and fungicidal.
Disinfectants are chemicals that kill microorganisms in liquid form. To kill the germs that are present on the surfaces of non-living things, they are typically administered to those surfaces. In order to eliminate infectious microorganisms, disinfectants are typically used in hospitals, kitchens, restrooms, etc.
Disinfectants come in a variety of forms, and the type to employ depends on the type of bacteria involved. When there is a chance that a surface has been contaminated with infectious agents, disinfectants are utilised.
The disinfectant phenol is used to denature and coagulate the proteins of microorganisms. In domestic settings, phenol is used to clean floors. The efficiency of phenol has so always been likened to disinfection.
Learn more about disinfectants:
brainly.com/question/28064988
#SPJ4
Answer: The advancement in the science and technology also comes with some of the risks which needs to be maintained at the time of surgery.
Explanation:
The fluoroscopy involves the use of X-rays, a form of ionizing radiation which increases the chances of radiation induced cancer.
Though this risk depends on the risk length of procedure and intensity of rays.
The higher intensity of the rays can also cause burns on the skin which can be equivalent to the sun burns.
The brightness of the screen is also introduced so that the patient is exposed to less intensity of rays.
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
From smallest to largest the levels of ecosystem organization are:
Organism
Population
Community
Ecosystem
