1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reil [10]
3 years ago
6

WILL GIVE A BRAINLEST

Biology
2 answers:
Readme [11.4K]3 years ago
3 0
This would be plant photosynthesis because they take in carbon dioxide
BartSMP [9]3 years ago
3 0
The answer you are looking for plant photosynthesis. This is the process when a plant sucks in carbon dioxide and breaths out oxygen
You might be interested in
In one family, all three children are homozygous for a recessive gene. What can be concluded about the parents?
mina [271]
It can be concluded that both parents are also homozygous recessive for the gene
8 0
2 years ago
What is an example of a biological system?
Stells [14]

A biological system is a complex network of biologically relevant entities. ... Examples of biological systems at the macro scale are populations of organisms. On the organ and tissue scale in mammals and other animals, examples include the circulatory system, the respiratory system, and the nervous system. source: google

6 0
2 years ago
Read 2 more answers
The contracting and relaxing of the heart is known as the?
kipiarov [429]

Answer:

Cardiac Cycle

Explanation:

Contracting= Systolic

Relaxing=Diastolic

5 0
3 years ago
¿Cuales son las principales diferencias entre<br> las mitosis la<br> meiosis?
Pavel [41]
It’s megabyte tho it’s gave hay Ab budget
5 0
3 years ago
Does anybody know this?
marishachu [46]
We can’t see what you’re talking about :( there’s no image or anything on my end
3 0
2 years ago
Read 2 more answers
Other questions:
  • Compare and contrast the contributions of Neel, Pauling, and Ingram to our understanding of the genetic and molecular basis of s
    8·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • ???????????????????????????????????????
    11·1 answer
  • For a substance to change from a liquid to a solid what must happen to its particles?
    5·2 answers
  • in an effect to reduce global warming, individuals and companies have been buying ------------------to fund restorative projects
    8·1 answer
  • Assuming that coleman’s hypotheses about the ob and db genes are correct, rank the mice by the amount of appetite-suppressing ho
    11·1 answer
  • Imagine you are standing in a field and you see a group of butterflies. You notice that the butterflies are not identical to eac
    10·1 answer
  • Stomata open and close in response to-
    5·2 answers
  • The word clone comes from which Greek word?
    5·1 answer
  • Which is a benefit of genetic counseling?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!