1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MA_775_DIABLO [31]
2 years ago
14

Select all that apply. Which fungi are used in medicine? penicillium Rhizopus stolonifera yeast aspergillus

Biology
1 answer:
sleet_krkn [62]2 years ago
8 0

Answer:

jjdjsjsknsnjsjsujnsbsjsnnbx

You might be interested in
Put the following steps in the correct order from 1-9
storchak [24]

Answer:

transcription of mRNA from DNA

small ribosomal subunit binds to mRNA

initiation complex formed with addition of large ribosomal subunit

translocation

codon recognition (non-initiating site)  

peptide bond formation

ribosome reads a stop codon

polypeptide chain is released from the P site

ribosomal subunits dissociate

Explanation:

The above describes the process of translation in the ribosome. After transcription of DNA to mRNA, the mRNA is taken to the ribosome to undergo translation, here the mRNA binds to the small ribosomal subuits and to other initiation factors; binding at the mRNA binding site on the small ribosomal subunit then the Large ribosomal subunits joins in.

Translation begins (codon recognition; initiating site) at the initiation codon AUG on the mRNA with the tRNA bringing its amino acid (methionine in eukaryotes and formyl methionine in prokaryotes) forming complementary base pair between its anticodon and mRNA's AUG start codon. Then translocation occurs with the ribosome moving one codon over on the mRNA thus moving the start codon tRNA from the A site to the P site, then codon recognition occurs (non-initiating site again) which includes incoming tRNA with an anticodon that is complementary to the codon exposed in the A site binds to the mRNA.

Then peptide bond formation occurs between the amino acid carried by the tRNA in the p site and the A site. When the ribosome reads a stop codon, the process stops and the polypeptide chain produced is released and the ribosomal subunits dissociates.

6 0
2 years ago
What reads the sequence of the mRNA? What are three nucleotides that code for an amino acid called?
Anit [1.1K]
The amino acid is aug
7 0
3 years ago
Which could cause a
brilliants [131]
It’s actually D!If the prey can’t eat enough food because of limited plants they die off which means the predators die off!
6 0
2 years ago
Which one of the following parasites affect all domestic animals?
Vaselesa [24]

Answer:

D fleas affect all animals

4 0
2 years ago
Read 2 more answers
What is an example of parasitism in Finding Nemo? Remember, the parasite has to be living on or in the host.
yKpoI14uk [10]
The fish that were following the other fish around.
7 0
3 years ago
Other questions:
  • Another word for K-strategist
    10·2 answers
  • How do we classify finger prints?
    13·1 answer
  • How do cells maintain water balance through osmosis?
    14·1 answer
  • How do particles in the same state/phase move?
    13·1 answer
  • The abbreviation for a sudden deficient supply of blood to the brain lasting a short time is
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What occurs to the cell during mitosis?
    15·2 answers
  • Mean by adaptation. ​
    9·2 answers
  • What traits could represent the phenotype of an organism ?
    12·1 answer
  • The eye, heart in skin of a pig, and a leaf from an oak tree are all examples of_______. They are groups of tissues join togeth
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!