1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vagabundo [1.1K]
3 years ago
5

PLSS HELP!! I WAS NOT PAYING ATTENTION IN CLASS!! I WILL GIVE YOU BRAINLYEST!!!

Biology
2 answers:
Natalija [7]3 years ago
7 0
Plant!!!!!!
algae!!!!!
navik [9.2K]3 years ago
4 0

Answer:

Plants, algae, and a group of bacteria called cyanobacteria are the only organisms capable of performing photosynthesis.  Because they use light to manufacture their own food, they are called photoautotrophs.

Explanation:

You might be interested in
Chemical reactions that release energy
Alik [6]
The answer is B.hope this helps
8 0
3 years ago
¿Tres diferencias entre el ADN y ARN?
Dmitry [639]
1-DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.
2-DNA is a double-stranded molecule, while RNA is a single-stranded molecule.
3-DNA is stable under alkaline conditions, while RNA is not stable.


Hope this helps you!!!:) You can translate this into Spanish!
6 0
3 years ago
A/An _______ exists when different concentrations of a substance exist on either side of a membrane.
Alecsey [184]

Answer:It is known as a concentration gradient which in diffusion will always flow from ares of high concentration to areas of low concentrations  

So i believe the answer to this is A.

Explanation:

4 0
3 years ago
A partir del concepto de osmorregulación cual es la regulación hídrica y salinas en peces de agua dulce y salada
maks197457 [2]

Answer:

Absorben o excretan agua salada para mantener la homeostasis.

Explicación:

La regulación hídrica y salina en peces de agua dulce y salada se realiza según las condiciones ambientales. Los peces pueden pasar mucha orina muy diluida en la que hay menos solutos o sales, y logran el equilibrio de electrolitos en el cuerpo mediante el transporte activo de sales a través de las branquias. En un ambiente marino hipertónico, los peces de agua salada comienzan a beber agua de mar y mantienen el equilibrio electrolítico mientras excretan el exceso de sales a través de sus branquias y su orina.

6 0
3 years ago
13. Keep a
ryzh [129]
D: fitness journal



It’s correct
5 0
3 years ago
Read 2 more answers
Other questions:
  • The product(s) of the Calvin cycle is (are) Your answer: A) ATP and NADPH. B) glucose and oxygen. C) just glucose. D) ATP and gl
    11·1 answer
  • Henry bought 280 red and blue paper cups. He used of the blue
    13·1 answer
  • What do well call it when two or more genes determine an organisms trait?
    12·2 answers
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • 4. In an experiment, suppose that the wings of fruit flies were clipped short for fifty generations. The fifty-first generation
    9·1 answer
  • Give two roles of nucleus in the cell​
    7·1 answer
  • Where is dense connective tissue found?
    7·1 answer
  • What is the difference between eukaryote and prokaryote
    11·1 answer
  • Morgan has diabetes and must carefully monitor his food intake. He is learning the calorie count of the different macromolecules
    5·1 answer
  • Deforestation of an area can reduce precipitation. Which of the following is a possible cause for this change?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!