1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vadim26 [7]
3 years ago
11

In plants water is transported through?​

Biology
2 answers:
Artyom0805 [142]3 years ago
6 0

Answer:

Water is sucked up xylem by mass flow (cohesion-tension) which decreases the water potential in the root xylem. So water diffuses through the root cells to the xylem which decreases the water potential in the root epidermis cells, so water diffuses into root hair cells from soil by osmosis.

Explanation:

igomit [66]3 years ago
4 0
The roots ok and then stems
You might be interested in
Help please?<br><br> List 3 characteristics of solids.
Inessa05 [86]
Has it own shape
Has volume
Has mass
5 0
4 years ago
Read 2 more answers
Which statement best describes the relationship between photosynthesis and cellular respiration?
KiRa [710]

Correct answer choice is :


<h2>A) Photosynthesis removes carbon from the atmosphere, and cellular respiration releases carbon back into the atmosphere.</h2><h2 /><h2>Explanation:</h2><h2 />

Photosynthesis produces the glucose that is utilized in cellular respiration to make ATP. The glucose is then converted back into carbon dioxide, which is utilized in photosynthesis. While water is broken down to form oxygen through photosynthesis, in cellular respiration oxygen is blended with hydrogen to form water.

5 0
4 years ago
Read 2 more answers
¿Cómo se llama el proceso de señalización en el que las señales se secretan hacia el torrente sanguíneo y se distribuyen por tod
Ira Lisetskai [31]

Answer:

c.Endocrina

Explanation:

El sistema endocrino consta de órganos que producen sustancias químicas especiales llamadas hormonas.

Las hormonas son mensajeros químicos secretados directamente en el torrente sanguíneo que regulan diversas actividades en el cuerpo.

Por lo tanto, el sistema endocrino secreta sustancias químicas en el torrente sanguíneo.

7 0
3 years ago
Between species DNA show
djyliett [7]
<h2>Answer and Explanation</h2>

DNA is called deoxyribonucleic acid. DNA is different in all plants and animals but according to the chemical structure, it is the same as double helix strand that is separated from each other. In a person body, all the DNA are the same but they are different if the cells, tissues, and organs are different. There are some mammals have slightly similar DNA that is humans have 99.6% same DNA as the chimpanzees.

5 0
4 years ago
Which fossil organism in whale evolution was the first to live mostly in water?
balu736 [363]
During the research Ambulocetus would be the first to consistently stay in water and Set over time they developed feet arms and <span>hands used to swim.</span>
5 0
4 years ago
Other questions:
  • Explain light independent reactions
    8·1 answer
  • What level has the most available energy<br>​
    11·2 answers
  • Where is ATP produced
    13·1 answer
  • What happens during crossing over and what is the significant?
    11·1 answer
  • BEST ANSWER GETS BRAINLIEST!!!!!!
    15·1 answer
  • the amount of oxygen in a fish tank is a _____ ______ that affects the amount of fish that can live in the tank
    8·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • When discussing total number of chromosomes, n or 1n =<br> A.diploid<br> B. haploid
    14·1 answer
  • Select all that are true. A short tandem repeat (STR):
    14·1 answer
  • An isotonic cell is always surrounded by an adjacent solution that is__________?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!