1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly [62]
3 years ago
5

(50 points) Think about the renewing of cells in a human body. What would happen if new cells stopped forming when we reached ma

turity while old cells never died off? Then consider what would happen if new cells continued to form while old cells never died off?
Biology
2 answers:
MariettaO [177]3 years ago
8 0

Answer:

We would gradually decay, and it would be horrific, and if new cells contiued to form it would also be pretty horrific

Explanation:

If we reached maturity while old cells never died off , this would heighten the risk for genetic and hereditary disorders, and new cells are not formed through mitosis, and are unable to replace inefficient or cells with damages, whether it not be to the DNA or other organelles.This would cause a significant decline of production in our body, and would also cause cells such as your skin cells, to be at a heightened risk of genetic and hereditary disorders and diseases such as cancers and melanomas

If our cells continued to form while old ones never died off, if would also be very inefficient for our bodies, as the amount of energy and ATP required to support an ever-growing cell population of that size would leave us wanting to eat more and more each day to fufill our daily metabolic processes, leaving us skinny and weak.This would also cause a loss of some function in some areas, because some areas require more energy than others, such as your pulmonary and cardiovascular system, and could result in wasting of muscle tissure, as they would not be getting the nutrients needed

Basile [38]3 years ago
5 0

If new cells would stop forming once maturity is reached, and old cells would never die. Genetic disorders would be more common, cells with damage would not be replaced, hereditary disorders would also be more common, such as cancers and others. If new cells continued to form and old cells would never die off, the amount of energy that is required to normally support us would leave us wanting more food each day to achieve our metabolic process.

You might be interested in
Which good container is suitable for transporting food
Zielflug [23.3K]
Plastic tupperware containers
8 0
3 years ago
Please help meeeeee
Brums [2.3K]
Sorry i needed the points... good luck tho
7 0
3 years ago
Read 2 more answers
What is d difference between epithelial cells and epidermal cells​
ASHA 777 [7]

<em>Answer:</em>

<em>It is the uppermost layer of the three layers of the skin. Summarily, the epithelium is a more general concept, and epidermis is the one type of epithelium, which is a more limited word indicating exterior part of the skin.</em>

<em />

<em>Explanation:</em>

<em>*Hope this helps*</em>

<em />

5 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
How do organisms get the energy they need?
SVETLANKA909090 [29]

Organisms get the energy they need from food just like us humans do.

6 0
3 years ago
Other questions:
  • If an organism expresses a recessive phenotype, can you tell the genotype? Explain your answer by giving an example.
    6·1 answer
  • Multiple sclerosis is a demyelinating disease in which the patient's immune system attacks and destroys the cells that form the
    12·1 answer
  • Which term refers to a cell that has more solute on the inside than on the outside?
    12·2 answers
  • Over the decades local and global ice ages have lowered sea levels. As a result, there is often a decline in marine diversity du
    7·2 answers
  • How do human activities lead to primary succession?
    13·1 answer
  • Please help I’ll give brainliest
    10·1 answer
  • It is not always possible to measure every individual in a population; what is the name of the representative group?
    8·1 answer
  • Un deportista quiere batir la
    13·1 answer
  • What type of plant is this?
    13·2 answers
  • Help pls will mark brainlist ​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!