1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gizmo_the_mogwai [7]
3 years ago
5

In which of the following does meiosis play a more significant role than mitosis?

Biology
1 answer:
egoroff_w [7]3 years ago
4 0
The answer is D, increasing genetic variation
You might be interested in
Where is carbon NOT found
alisha [4.7K]
It’s not found in inorganic matter
5 0
2 years ago
Read 2 more answers
Why was the Selective Service Act an important step toward winning world war 1 ?
nata0808 [166]
It provided the large numbers of troops needed to reinforce the Allied effort.
8 0
3 years ago
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
2 years ago
Name three resources for which organisms might compete
lubasha [3.4K]
Hello!

Organisms might compete for food, pH, temperature, territory, and water.
8 0
2 years ago
17. The lungs and
Slav-nsk [51]
I believe the answer is B. Heart
8 0
3 years ago
Other questions:
  • Which reason best explains why carbon is able to form macromolecules
    11·1 answer
  • The reproductive organs of both sexes are designed to produce and permit fertilization of the germ or "seed" cells called
    5·1 answer
  • Oceanic crust is generally lower in elevation than continental crust because oceanic _____ is _____ than continental crust.
    10·1 answer
  • Four (or five) cardinal signs indicate inflammation. what specific sign of inflammation is the result of exudate in the tissue s
    11·1 answer
  • How does the melting of the ice caps affect the amount of salt in the water?
    7·1 answer
  • Cuál es el órgano más grande el sistema nervioso que regula el equilibrio del cuerpo y controla los movimientos
    14·2 answers
  • Explain how the results of the experiment show the major function of the integumentary system. and will make brainiest.
    7·1 answer
  • Which type of bond is formed in nitrogen gas?
    5·2 answers
  • What does a tortoise covering body do for it?​
    8·1 answer
  • a cell that is metabolic active but not actively dividing is considered to be in which phase of the cell cycle?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!