1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
3 years ago
14

HELP ME!!!! I’m so confused and this is a test

Biology
1 answer:
erastovalidia [21]3 years ago
5 0

Answer: its b i think if wrong then i will change it

Explanation:

You might be interested in
During transcription in eukaryotes, a type of RNA polymerase called RNA polymerase II moves along the template strand of the DNA
mr Goodwill [35]

Answer:

xxxxxx

Explanation:

6 0
3 years ago
4. The outermost structure in all prokaryotic cells.​
Doss [256]
The external structures of the prokaryotic cell include a plasma membrane, cell wall, and capsule (or slime layer).
3 0
3 years ago
In a __________, organisms are particularly susceptible to certain kinds of stimuli in their environments, but the absence of th
vivado [14]
The time period being referred to is the sensitive period. This time period is also referred to as the critical period. The importance of a critical period is such that it must involve certain stimuli from which an organisms learns and acquires traits. If some of these stimuli are not present in the critical period, the organism has difficulty acquiring the trait or skill, and may even find it to be impossible to learn the skill.
5 0
3 years ago
Read 2 more answers
How can mutations be helpful? Give 2 examples
RSB [31]
Having two copies of the mutated genes cause sickle cell anemia, but having just one copy does not, and can actually protect against malaria - an example of how mutations are sometimes beneficial. 

The majority of mutations have neither negative nor positive effects on the organism in which they occur. These mutations are called neutral mutations. Examples include silent point mutations. They are neutral because they do not change the amino acids in the proteins they encode.

Hope this helped :)
6 0
3 years ago
Which is the best example of a hypothesis leading to new experimental methods?
77julia77 [94]

The best example of hypothesis which leads to new experiment methods was done by Morgan where he used fruit flies.

Thomas Hunt Morgan continues on genetic research which is of Gregor Mendel.

6 0
3 years ago
Read 2 more answers
Other questions:
  • What covers the ends of bones in adults?
    10·2 answers
  • In the cross BB x bb, the percent of offspring in the F1 generation that will have the same genotype as one of their parents is
    9·1 answer
  • This is a process by which substances are transported across cell membranes by means of protein carrier molecules.
    12·2 answers
  • Which solution is more concentrated?
    9·1 answer
  • 1. Define especie biologica, población, especiación y mecanismos de aislamiento reproductivo.
    12·1 answer
  • Many types of scientific equipment are used to perform different functions in the science lab. Which of the following combinatio
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • (GIVING BRAINLIEST AND EXTRA POINTS!!)
    12·1 answer
  • Pleas help... pleas help pleas help!!!!!
    12·1 answer
  • The term for genetic testing on embryos for genes that cause untreatable or severe diseases is:________
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!