1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sliva [168]
2 years ago
9

Quick help plz ......The presence of starch in leaf is tested using​

Biology
2 answers:
Vera_Pavlovna [14]2 years ago
6 0

Answer:

Hey!

Your answer is The presence of starch in leaves is testing with the Iodine test!

Explanation:

The presence of starch in the leaf would be represented by the blue / black tint of the Iodine when put on the sample...

Iodine solution is used to test leaves for the presence of starch...heat a plant leaf in boiling water for 30 seconds...

Check that it is soft before removing it out of the beaker...

Spread on a WHITE tile...

And now place a few drops of Iodine onto the leaf...

*if it turns dark (blue/black), STARCH IS PRESENT*

*no real change in colour means there is not starch present!*

HOPE THIS HELPS!!

XD

laila [671]2 years ago
5 0

Answer:

The presence of starch in leaves is testing with the Iodine test.

Explanation:

First, chlorophyll is removed from the leaf by boiling it in alcohol.

Then, two drops of iodine solution are put onto the leaf.

If the colour changes to blue, it indicates the presence of starch.

If it does not, there is no starch.

I hope this helps!

-Bella

<em>BrainlyBluebell</em>

You might be interested in
The use of _____ during pregnancy is most associated with premature birth, low birth-weight infants, and fetal death. nicotine c
rusak2 [61]

The drug that is associated when having to intake it when pregnant that is likely causing premature birth, low birth weight infants and the fetal death is the use of nicotine. This type of drug is a form of agonist in regards with nicotinic acetylcholone receptors.

4 0
3 years ago
Read 2 more answers
A child is born with downsyndrome when did the mutation occur
Reil [10]
It occurred during meiosis.
just took the test, hope this helps:)
4 0
2 years ago
What two stages are involved in the energy generation process
Luba_88 [7]
Respiration is one of them

8 0
2 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
If athletes ¨pasta load¨ they consume a
vredina [299]
The answer is they consume carbs
5 0
2 years ago
Other questions:
  • What happens to the water after it rains
    15·1 answer
  • The proteins around which human DNA is wound are
    7·1 answer
  • The sequence of ________________ in a DNA molecule determines the protein that will be produced. A) lipids B) nucleotides C) pro
    13·2 answers
  • What is lightning?
    13·1 answer
  • How the layer of the earth connected and affected by each other
    7·1 answer
  • The behavior of an organism is influenced by both internal and external factors. How might a bear be influenced by external fact
    14·2 answers
  • 3. Which structures carry out life functions within cells?
    8·1 answer
  • Fill in the blanks:
    12·1 answer
  • Cervical vertebrae can be uniquely identified by the presence of:.
    15·1 answer
  • At which point (A or B) on this
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!