lysosomes and vacuoles both are cell organelles that are membrane bound, and used for storage.
lysosomes contain/ store digestive enzymes and also known as suicidal bags.
vacuoles contain/ store undigested/ waste materials
Answer:
The presence of photosynthetic pigments.
A supply of carbon dioxide.
A supply of water.
Light energy.
A suitable temperature.
Explanation:
Answer:
<u>A. Large amounts of water force open cracks in rocks</u>
Explanation:
Hydraulic fracturing, or fracking, is a drilling method used to extract petroleum (oil) or natural gas from deep in the Earth. In the fracking process, cracks in and below the Earth's surface are opened and widened by injecting water, chemicals, and sand at high pressure.
A is basically explaining this the same way. Forcing cracks in the ground with liquids.
Hopefully I was a help to you. If not I am sorry and I wish you the most wonderful of days. :)
Answer: doctor may be able to determine the cause by listening to your medical history and doing a physical exam. If necessary, they also can order a blood or urine test to help confirm a diagnosis, or a "culture test" of tissue to identify bacteria or viruses.
Explanation:
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
