1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
3 years ago
12

Please answer number 12

Biology
1 answer:
BARSIC [14]3 years ago
4 0

Answer:

B

Explain no explanation sorry

You might be interested in
Which behavior is a response that is determined by heredity?
Alexandra [31]
The answer is it is sleeping
6 0
3 years ago
Read 2 more answers
Which is not part of Darwin's theory of natural selection?
hjlf

Answer:

Hi. I think the answer is A.

7 0
3 years ago
Balanus is inferior to chthamalus in competing for space on rocks lower in the intertidal zone.
pshichka [43]
The removal of Balanus shows that the realized niche of Chthamalus is smaller than its fundamental niche. <span>These two species of barnacle do not show competitive exclusion.</span>
6 0
3 years ago
List two ways that trees help cities.
tresset_1 [31]

Answer:

Trees give off oxygen that we need to breathe. Trees reduce the amount of stormwater runoff, which reduces erosion and pollution in our waterways and may reduce the effects of flooding.

Explanation:

Hope that helps

7 0
3 years ago
Read 2 more answers
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi
Likurg_2 [28]

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

7 0
3 years ago
Other questions:
  • Which feature is found in eukaryotic cells but not in prokaryotic cells​
    15·2 answers
  • Explain the relationship of inheritance,mutations,and common ancestry
    14·1 answer
  • What does a nucleus do in an animal cell an animal cell, what does a Nucleus do?
    15·2 answers
  • Consuming a meal high in salt will:_________. a. activate the renin-angiotensin mechanism. b. result in a temporary increase in
    9·2 answers
  • together all of an individuals genes are called his or her? a.)genomes b.)chromosome c.)nucletide d.)species
    6·1 answer
  • The endoplasmic reticulum is needed for O detoxification O synthesis of certain proteins O hormone synthesis synthesis of lipids
    9·1 answer
  • Which lists the steps of Meiosis II in the correct order?
    5·1 answer
  • Why is an enveloped virus unable to infect any other cell type?
    11·1 answer
  • The only taxonomic category in which microevolution can occur is the ________ level.a. domain.b. species.c. genus.d. kingdom.e.
    6·1 answer
  • Arrange the following events in the order in which they occurred.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!