1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
3 years ago
6

Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi

s sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.
Biology
1 answer:
Likurg_2 [28]3 years ago
7 0

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

You might be interested in
Which level of organization is the highest?
Juli2301 [7.4K]
<span>Which level of organization is the highest? It would be the tissue if you are describing the broadest category
 </span>
8 0
4 years ago
Read 2 more answers
All of the following can occur along the subduction zones EXCEPT:
Anastasy [175]

Answer: polar ice caps form

Explanation:

7 0
4 years ago
Which pairs are MOST closely related?
jasenka [17]

Answer:

C) amoeba and bacteria

Explanation:

Both are single celled organisms

6 0
4 years ago
Read 2 more answers
A student placed a disk of filter paper in each of the following solutions: disinfectant 1, disinfectant 2, disinfectant 3, and
Ludmilka [50]
<span>The disinfectant that was the most effective at controlling the growth of E. coli is disinfectant 2 because of the least number of Ecoli strains found on the dish compared to the other disinfectants. Also dish 4 that cointains water has the most number of Ecoli strains because water is not a disinfectant and Acoi do not die in water alone.</span>
3 0
3 years ago
Using an example (from class or another) and one of the forms of evolution, explain in a short paragraph the true scientific mea
vitfil [10]

There are basically three types of evolution divergent, convergent and parallel evolution.

a) Divergent Evolution – As the name depicts the species in this form of evolution becomes divergent i.e they evolve to become different from each other. This form of evolution is responsible for the current diversity of organisms existing on planet earth. For example human and apes evolved from a common primate ancestor.

b) Convergent Evolution – In this evolution, different species of organisms living in a similar biosphere start share common traits in the form of analogous features. For example – Whale and fish are not closely related species but they both have fins which are different in structure but have the same function.  

c) Parallel evolution – In this evolution the similar characteristics between the two set of organisms are maintained though the two species continue evolving separately. For example - marsupial mammals of Australia and the Placental mammals

3 0
3 years ago
Other questions:
  • Consider the cell structure that is shown below. mc015-1.jpg Which is a function of the structure that is represented in the ima
    11·2 answers
  • If a male dog has 20 chromosomes in his sperm cell, how many does he have in his body cell?
    7·1 answer
  • CAN SOMEONE HELP ME PLEASE!!
    6·2 answers
  • Which method(s) can be used to join double-stranded breaks in DNA? (choose all that apply)
    5·1 answer
  • Suppose the two possible alleles for the height gene are tall and short. If short is recessive to tall, provide the symbol repre
    7·1 answer
  • Are sharks mammals?​
    11·2 answers
  • What type of cell changes to fit where needed?​
    13·1 answer
  • Explain how neuroprosthetic devices work.
    11·2 answers
  • Climate zones change with changes in latitude. This may be mimicked by changes in?
    6·1 answer
  • Select the TRUE statement about a resting neuron. a.) The cytoplasm side of a neuron is positively charged while the outside of
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!