1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
3 years ago
6

Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi

s sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.
Biology
1 answer:
Likurg_2 [28]3 years ago
7 0

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

You might be interested in
The _____ consists of protoplasm and a nucleus.
Nady [450]
The _____ consists of protoplasm and a nucleus.D. Pseudopodium

8 0
3 years ago
Read 2 more answers
How are the lydias ice and lyric cycles different
Serjik [45]

Answer:

The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell. The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within.

Explanation:

4 0
3 years ago
will give crown!!!!!!!!!!! Kevin made a playlist of five songs and set his player to select the songs at random, allowing for re
Sunny_sXe [5.5K]

Answer:1/625

Explanation:

4 0
3 years ago
What element is all life based upon
STALIN [3.7K]

Answer:

what element is all life based on

Explanation:

the element is element carbon

7 0
4 years ago
Please help me with this​
Nitella [24]

Answer:

All four forces are acting in the same direction

7 0
3 years ago
Read 2 more answers
Other questions:
  • Answer the question pls
    13·1 answer
  • Which scenario would result in a decrease in population size, or a negative population growth?
    13·2 answers
  • What are the main risk and main benefit of a society using geothermal energy?
    6·2 answers
  • Whats the difference between a plant and animal cell?
    14·2 answers
  • in the polymerization of dna, a phosphodiester bond is formed between a phosphate group of the nucleotide being added and _____
    6·1 answer
  • What is considered the first stage of the cell cycle?
    5·1 answer
  • What is the general process scientists use to gather information and answer questions
    10·2 answers
  • Which of the following animals has a heart in which oxygenated and deoxygenated blood mix?
    15·1 answer
  • Sheeeeeeeeeeeeeeeeeeesh
    10·2 answers
  • Nthesis?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!