1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
3 years ago
6

Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi

s sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.
Biology
1 answer:
Likurg_2 [28]3 years ago
7 0

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

You might be interested in
Phytoplankton are so tiny you need a microscope to see them. How do they affect the global carbon cycle?
Ksju [112]

Answer:

Phytoplanktons are microscopic creatures that are primary producers of oceans. Phytoplanktons take carbon dioxide from atmosphere to make their food and then they are eaten by some other animals of oceans.

Phytoplanktons are present in huge numbers in oceans and have a great contribution to the carbon cycle because it is responsible for the transfer of carbon dioxide from the atmosphere to the oceans.  

Most of the carbon is released through combustion by animals that eat phytoplanktons but some accumulate in the ocean floor because some dead phytoplanktons settles down in the ocean.

6 0
3 years ago
Which is true male genotype in the ZW sex chromosome system?
Akimi4 [234]

I’m pretty sure males are ZZ. Let me know if I’m right and have a good rest of your day!

8 0
3 years ago
I NEED AN ANSWER ASAP<br> What is an example of stewardship??<br> THANK YOU SO MUCH!!
kati45 [8]

Stewardship is taking care of something like a large household, the arrangements for a group or the resources of a community. An example of stewardship is the responsibility of managing the staff of an estate. An example of stewardship is the act of making wise use of the natural resources provided by the earth.

3 0
3 years ago
Which part of the microscope would you turn to go from low to high power?
Naddik [55]

Answer:

Fine Adjustment Knob

Explanation:

3 0
4 years ago
Read 2 more answers
Michelle has been given a microscope slide that contains a eukaryotic cell and a prokaryotic cells what should she look for to d
Bess [88]

Prokaryotic cells have flagellums. Eukaryotic has a nucleus

5 0
3 years ago
Other questions:
  • Why is organic food better and healthy?
    8·1 answer
  • What is the molecular formula for an organic compound
    12·1 answer
  • Diffusion can be fined as what​
    15·1 answer
  • Non-renewable natural resources like oil and natural gas take a very long time to form. That is one reason for the building of w
    8·1 answer
  • !!!!!!!!!!PLEASE ANSWER QUICK!!!!!!!!!!!WILL MARK BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    8·1 answer
  • Which word from the press release addresses Marquez's wide range of writing?
    13·2 answers
  • After a zygote undergoes cleavage division it is called a ____
    10·2 answers
  • A hydrocarbon consists of four carbon atoms with one double bond. Predict the molecular formula of this compound.
    13·2 answers
  • ¿Se pueden transferir mutaciones en todo tipo de células a la generación futura?
    11·2 answers
  • I hope you can help me &lt;3
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!