All categories

2 years ago

Why do biologists classify

Biology

2 answers:

ohaa [14]2 years ago

7 0

Answer: It is because it makes it more efficient to study organisms.

Explanation: Biologist classify organisms by considering similarities between them. The organisms which have closely related characteristics are placed in a separate domains by biologists. Domains are further divided into 6 Kingdoms. According to modern classification system, domain is largest unit of biological classification.

Vadim26 [7]2 years ago

5 0

Answer:

Biologists classify organisms because:

Classification allows us to understand diversity better.
It helps in the identification of living organisms as well as in understanding the diversity of living organisms.
Classification helps us to learn about different kinds of plants and animals, their features, similarities and differences.
It enables us to understand how complex organisms develop from simpler organisms.
They are grouped under different categories to understand and study the features, similarities and differences between different living organisms.
It is essential to understand the inter-relationships among the different groups of organisms.

Classification forms a base for the development of other biological sciences.

You might be interested in

For each sequence of DNA is shown. Write the complementary RNA sequence underneath the letters, thenuse the codon chart to deter

Dmitriy789 [7]

Answer:

DNA → TACCATGGAATTACT

RNA → AUGGUACCUUAAUGA

PROTEIN → Methionine-Valine-Proline-Stop codon-Stop codon (AUG GUA CCU UAA UGA)

Explanation:

In nucleic acids (i.e., DNA and RNA), base complementarity refers to the interaction between antiparallel strands. In the double helix DNA molecule, adenine always interacts with thymine (uracil in RNA), while cytosine always interacts with guanine. Moreover, amino acids are encoded by codons, i.e., triplets of nucleotides in the messenger RNA (mRNA). Finally, stop codons are triplets of mRNA nucleotides (e.g., UAG, UAA, UGA) that indicates the end of the protein-coding sequence.

8 0

2 years ago

Negative feedback occurs when the output of a pathway ____________ input to the pathway. Feedback loops are used extensively to

Sveta_85 [38]

Answer:

Inhibits

Explanation:

Some mechanisms are essential for maintaining homeostasis in the human body. One of the most used mechanisms by our body is the negative feedback system. It causes a negative change from the initial change. As mentioned in the question, this often happens in the hypolamo-pituitary axis, such as when the adrenal cortex produces cortisol, this same cortisol inhibits the adenohypophysis and hypothalamus. It's also important to mention that deregulation in this process can lead to an undue chronic increase in cortisol and can lead to diseases such as anxiety disorder.

6 0

3 years ago

What mineral is released within muscle cells to trigger contraction?

astraxan [27]

Answer:Troponin

Explanation:

3 0

2 years ago

Cells form a ______ arrangement when cells in a chain snap back upon each other forming a row of cells oriented side by side.

Debora [2.8K]

Answer:

Palisade

Explanation:

8 0

2 years ago

Assembling a complete sequence from fragment sequences

Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0

3 years ago