<span>During photosynthesis, plants use carbon dioxide and produce oxygen. During metabolism oxygen is used and carbon dioxide is a product. Humans impact the carbon cycle during the combustion of any type of fossil fuel, which may include oil, coal, or natural gas.</span>
Go online and look up ressesive and dominate Gene's and Gregory Mendel he crossbreed plants such as what you have described and have found some interesting results that do include your red and white crossbreeding to create pink. this is usually called a Punnet Square.
dominate gene
Red = R
White = W
recessive gene
Red=r
White = w
pink is either a mixture of recessive and dominant Gene's or one dominant and one recessive
Nucleus’s it acts like the brain!
Answer:
Objects able to block all the light are called opaque and will form a shadow. ... The closer an object is to the light source, the larger the shadow it casts. This is because an object closer to the source will block a larger area of the light, increasing its shadow size.
Explanation:
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T