1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex_Xolod [135]
3 years ago
10

Which cell molecules would be used to make viral proteins?

Biology
1 answer:
dezoksy [38]3 years ago
7 0

Explanation:

In many cases, DNA viruses utilize cellular enzymes for synthesis of their DNA genomes and mRNAs; all viruses utilize normal cellular ribosomes, tRNAs, and translation factors for synthesis of their proteins.

You might be interested in
Does anyone know the answers
Aleksandr-060686 [28]
Heavy rain , strong winds
7 0
3 years ago
True or False: Humans have radial symmetry
aliina [53]

Answer:

false

Explanation:

not everyone has radial symmetry

6 0
3 years ago
Read 2 more answers
The breeding of two organisms that differ in a single trait
Mariana [72]
The correct answer is monohybrid cross
3 0
3 years ago
Which was the original source of atmospheric oxygen? Question 4 options: autotrophs cooling of Earth’s crust formation of the oc
Nuetrik [128]

Answer:

The answer is autotrophs

Explanation:

During the early days of the Earths life there was no oxygen but there was plenty of CO2 which the autotrophs took and used as food while discarding the excess which was the oxygen.

5 0
3 years ago
What is a point of view?​
nika2105 [10]

Answer:

point of view is a particular attitude or way of considering a matter.

Explanation:

pls mark brainliest

4 0
2 years ago
Read 2 more answers
Other questions:
  • What information can you obtain if you know a minerals use or chemical composition
    14·1 answer
  • Within the global water cycle, water is stored for the shortest amount of time in…
    6·1 answer
  • Which of the following behaviors is not a result of seasonal changes?
    14·2 answers
  • Mrs. Vega's science class incubated chicken eggs to see if any of the eggs would hatch. One of the eggs did hatch, and the class
    10·1 answer
  • The diagram shows the embryological development of a fish, salamander, turtle, and chick. The top of the diagram shows the early
    15·2 answers
  • What kind of weather does an occluded front produce?
    13·2 answers
  • Cheranita is experiencing the first stage of the general adaptation syndrome. an environmental stressor has triggered a process
    15·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which of the following genotypes could be described as homozygous dominant? A.Bb B.AA C.Xx D.tt
    12·2 answers
  • Yang is an agriscientist seeking to protect crops against pests. He selects plants that have shown a resistance to these pests.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!