Answer: The two major geographic features provided on the east and west boundaries of piece of land are:
1. The land is "Louisiana Purchase".
2. The east boundary is "Mississippi".
3. The west boundary is "The Rockies".
Explanation: The Louisiana purchase is a piece of land of about 530,000 acres which was sold by France to the US President which was Thomas Jefferson in 1804.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
ISCO-DUG-WUAZ
Explanation:
Seismic waves of an earthquakes is recorded first in the station closest to the earthquake. The P wave is the faster moving wave and then the S wave. The faster the time it takes the P and S waves to register in the seismographer the closer the station to the site of the earthquake. Bearing this in mind, the wave was first registered in ISCO making it closest to the earthquake site, followed by DUG and then WAUZ.
ISCO (14sec)-DUG (57sec)-WUAZ (73sec)
Answer:
Let coefficient of linear and area expansion be α a n d β respectively. where ∆ T is change in temperature. For simplicity let us consider the case of square of side L. Therefore, coefficient of area expansion is twice the linear expansion.
Monumental Axis is the central avenue in Brasilia's city design
Explanation:
The first section of the monumental avenue is known to be the "Ministries Esplanade" because it is enveloped by ministers building. Many important government buildings and monuments are established on the monumental axis.
Cathedral of Brasilia is present there in the monumental axis. It was constructed after 1950 as a plan to construct a modern city. It serves ti be the major transportation point. monumental axis have twelve lanes which marks to be the world' busy dual carriage way.
