Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Your answers are both evocative and active forces. Hope this helps.
Divergent boundary.
This is the boundary between two tectonic plates move away from each other in opposite directions.
Explanation:
One major example of a divergent boundary is the mid-Atlantic ridge that cuts, longitudinally, across the middle of the Atlantic ocean.
When two tectonic plates move away from each other in opposite directions, the void they leave in between is filled by rising magma from the mantle and cooling to create new crust. A mountainous ridge along a boundary is evidence of a divergent boundary. The Atlantic ocean will therefore continue to widen as the North American and Eurasian Plates move away from each other. As new crust is formed at divergent boundary, old crust is being consumed at convergent boundary on another end of earth. This way tectonic plates of earth renew themselves.
Learn More:
brainly.com/question/12655537
#LearnWithBrainly
It means a revervoir that is man-made (not natural).
Answer: The hardness of a mineral.
Explanation:
(give brainliest please!)