1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
3 years ago
8

The connection between limiting factors and invasive species

Biology
1 answer:
Yanka [14]3 years ago
7 0

Answer:

Biology, Ecology, Earth Science, Climatology, Geography

Explanation:

A limiting factor is anything that constrains a population's size and slows or stops it from growing. Some examples of limiting factors are biotic, like food, mates, and competition with other organisms for resources. Others are abiotic, like space, temperature, altitude, and amount of sunlight available in an environment. Limiting factors are usually expressed as a lack of a particular resource. For example, if there are not enough prey animals in a forest to feed a large population of predators, then food becomes a limiting factor. Likewise, if there is not enough space in a pond for a large number of fish, then space becomes a limiting factor. There can be many different limiting factors at work in a single habitat, and the same limiting factors can affect the populations of both plant and animal species. Ultimately, limiting factors determine a habitat's carrying capacity, which is the maximum size of the population it can support

You might be interested in
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
Genetic tendencies shape the environments to which people are exposed during life. nature shapes nurture through both _____ and
V125BC [204]
Your answers are both evocative and active forces. Hope this helps.
7 0
4 years ago
crustal formation,which may cause the widening of an ocean is most likely occurring at the boundary between...?
balandron [24]

Divergent boundary.

This is the boundary between two tectonic plates move away from each other in opposite directions.

Explanation:

One major example of a divergent boundary is the mid-Atlantic ridge that cuts, longitudinally, across the middle of the Atlantic ocean.

When two tectonic plates move away from each other in opposite directions, the void they leave in between is filled by rising magma from the mantle and cooling to create new crust. A mountainous ridge along a boundary is evidence of a divergent boundary. The Atlantic ocean will therefore continue to widen as the North American and Eurasian Plates move away from each other. As new crust is formed at divergent boundary, old crust is being consumed at convergent boundary on another end of earth. This way tectonic plates of earth renew themselves.

Learn More:

brainly.com/question/12655537

#LearnWithBrainly

7 0
4 years ago
What is the definition of Biotic Reservoir and what is the definition of density of water?
Levart [38]
It means a revervoir that is man-made (not natural).
4 0
3 years ago
Read 2 more answers
5. What property of minerals does Mohs' scale describe?
Irina-Kira [14]

Answer: The hardness of a mineral.

Explanation:

(give brainliest please!)

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which would be most effective in reducing indoor air pollution in an environment high in volatile organics (VOCs)? A) cover the
    9·1 answer
  • How can bias affect the application of science in society?
    6·1 answer
  • By which process CO2 pass through stomata.​
    8·2 answers
  • 1. Look at the illustration in the figure. Which of the following internal characteristics would you expect to this animal to ha
    8·1 answer
  • A college student takes a standardized test and scores a 163. if the mean is 155 and the standard deviation is 7, what is the st
    8·1 answer
  • Which of these describes the role of a chromosome in inheriting a trait?
    13·2 answers
  • Which two levels of ecological organization include members of only a single species?
    11·2 answers
  • Tax ____ is a policy that governments implement to make sources of environmental destruction pay for impacting that natural reso
    9·1 answer
  • A. Is the suspected father actually the father of this child?
    8·1 answer
  • Which organism would the researchers most likely predict to be the most distantly related to eukaryotes?.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!