Which organ is responsible for helping to keep the water concentration equal on each side of the cell membrane?

Name the two different types of nucleic acids

stepladder [879]

Answer: RNA and DNA are the main ones, but mRNA and rRna are some, too

Explanation:

3 0

3 years ago

Remembering only the negative aspects of a past relationship illustrates that memories are?

ale4655 [162]

Answer:

Explanation:

If you think of the negative memory’s you will look bad with regret. You wish it never happened. When you see a positive side it makes a whole new aspect of things.

7 0

3 years ago

Please Help.. Brainliest!!

mojhsa [17]

.Answer:

1. s-waves

2. s-waves

3. p-waves

4. p-waves

5.surface waves

Explanation:

A P-wave is one of the two main types of elastic body waves, called seismic waves in seismology. P-waves travel faster than other seismic waves and hence are the first signal from an earthquake to arrive at any affected location or at a seismograph. P-waves may be transmitted through gases, liquids, or solids.
a surface wave is a mechanical wave that propagates along the interface between differing media. A common example is gravity waves along the surface of liquids, such as ocean waves. Gravity waves can also occur within liquids, at the interface between two fluids with different densities
S-waves, secondary waves, or shear waves (sometimes called an elastic S-wave) are a type of elastic wave and are one of the two main types of elastic body waves, so named because they move through the body of an object, unlike surface waves.

Hope it helps answer the question!

8 0

3 years ago

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

Anarel [89]

Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.

4 0

3 years ago

healthy soil is able to provide all the nutrients that support plant growth and to do so year after year what biotic or a abioti

mote1985 [20]

Answer:

Expl A. Microorganisms that live in the soil or on plant roots

B. Water from rain or melted snow

Explanation: Soil is the base for plants to grow. A soil is termed as healthy soil which contains all the biotic and abiotic factors that are essential for the plant growth.

Biotic factors : Biotic factors include all the necessary living organisms that promote plant growth. Biotic factor mainly include bacteria , fungi , protozoa , algae etc.

Microorganisms made Symbiotic relationship with plant. They provide plant essential nutrients and plant provide them shelter.

Abiotic factors : Abiotic factors include non living factors such as air , water , sun light etc.

Water is most important abiotic factor for healthy soil. Water helps plant to transport essential nutrients present in soil through the plant. Water also gives plant stability in the soil.

Melted snow can also be used in place of water.anation:

4 0

2 years ago