1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LiRa [457]
3 years ago
7

Which of the following describes a missense mutation?

Biology
1 answer:
34kurt3 years ago
8 0

Answer:

C

Explanation:

The answer is C i think but i ould be wrong

You might be interested in
Regarding the order rhizobiales of the class alphaproteobacteria, which genus includes human pathogens?
Marat540 [252]
Regarding the order rhizobiales of the class Alphaproteobacteria, the genus that includes human pathogens is Brucella.
Rhizobiales are a type of Alphaproteobacteria, which are a type of Proteobacteria, which are Gram-negative bacteria.
Brucella is also a type of Gram-negative bacteria that can cause brucellosis, which is an infectious disease caused by eating unpasteurized milk or undercooked meat.
5 0
3 years ago
A good model of the cell membrane would be
Wewaii [24]

Answer;

C. A wall of stones and mortar

This would act as a model describing the cell membrane.

Explanation;

A cell membrane is made up of a phospholipid bilayer with embedded proteins.

A cell membrane hold the different components of the cell together and to protect it from the environment outside the cell. It acts as a boundary between the inside environment and the outside environment of a cell.

It regulates the materials that enters and exits the cell; through selective movement of substances in and out of the cell.

8 0
3 years ago
Read 2 more answers
I need to know what the Ghrelin is for school
Vaselesa [24]

Answer:

It is a hormone that increases appetite

3 0
3 years ago
Read 2 more answers
How many grams of sugar are in each serving?
Basile [38]

Answer:

37.5 grams

Explanation:

7 0
2 years ago
Read 2 more answers
A remote-controlled helicopter flew 826 meters west at a constant velocity. It flew that
frosja888 [35]

Explanation:

Distance = 826m

time = 70second

velocity = distance/ time

v = 826/70

v = 11.8m/sec

5 0
2 years ago
Other questions:
  • How does the abnormal shape of a sickled red blood cell affect its movement through blood vessels?
    15·1 answer
  • 6. Which of the following describes the frozen underground soil that is found in the tundra a. polar ice c. permafrost b. hard f
    14·1 answer
  • (04.03 MC) What will most likely happen in the absence of a nucleus?
    6·2 answers
  • What arrangement of electrons would result in a non-polar molecule
    15·1 answer
  • How do opinions compare to observations?
    5·1 answer
  • In the united states, the most at risk and highest reported rates of infection of gonorrhea are among sexually active ________.
    6·1 answer
  • This is the process of intentionally interfering with the breeding process to encourage certain traits over others.
    13·2 answers
  • True or false, the left lung in larger then the right lung?<br> Plz answer will mark brainest
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • An infectious disease is one that is caused by
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!