1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa [10]
3 years ago
14

What are the leaf like parts in simple flowers called

Biology
1 answer:
Nina [5.8K]3 years ago
8 0
Viens. :) Goodluck on your homework.
You might be interested in
Helphelp help gell help helpp
dimulka [17.4K]
I think bread; i’m 90% sure
5 0
2 years ago
If the forces acting upon an object are balanced, then an object MUST
In-s [12.5K]

Must be moving at a constant velocity

Hope this helps :)

4 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
What does the car have a tendency to do?
Artist 52 [7]

Answer:

break down/ or release gas into the air

Explanation:

a car's engine is limited when it is running for certain periods of time, this casues pollution as a result of gas expelled from the car

4 0
3 years ago
Canadian geese can fly approximately 75 miles in 3 hours is this speed, velocity, or acceleration?
Olenka [21]

Answer:

Speed

Explanation:

Speed is a scalar quantity that refers on how fast and object is moving, speed can be thought of as the rate at which and object covers distance. An object with no movement at all has a zero speed.

Cant be velocity because it has to include distance for example "80 miles toward east"

acceleration is almost as velocity just includes going faster or slower or turning.

Hope that helps :)

8 0
3 years ago
Read 2 more answers
Other questions:
  • PLZ HELPPPPP During one interval of the game of fetch, a dog ran 27 meters in 9 seconds.
    11·2 answers
  • Mutations can occur in the chromosomes of all types of cells. mutations that are passed on to offspring must occur in
    11·2 answers
  • 11) What is the important outcome of meiosis I?
    12·1 answer
  • One of the key innovations in the evolution of eukaryotes from a prokaryotic ancestor is the endomembrane system. What eukaryoti
    11·1 answer
  • Grass that changes energy from the sun into chemical energy is a?
    14·1 answer
  • Which is the best analogy for classification?
    11·2 answers
  • Use 2-3 sentences to describe what would if populations never evolved?
    8·1 answer
  • Answer the Question below with a short sentence.
    15·1 answer
  • What evidence supports Hess's theory of seafloor spreading?
    8·1 answer
  • Question in the picture
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!