1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
6

Help me please this is due in 30 minutes

Biology
2 answers:
Phoenix [80]3 years ago
8 0

the producer in the food chain is corn.

ddd [48]3 years ago
7 0

Answer:

moth is herbivore because they only eat plants

mice is a omnivore because they eat both plants and animals

and producer is corn because producers are plants because they make their own food through Photosynthesis

and sorry I don't know the other one

You might be interested in
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
Describe how a substrate interacts with an enzyme.
Ilya [14]

Answer:

Enzymes bind with chemical reactants called substrates. There may be one or more substrates for each type of enzyme, depending on the particular chemical reaction. In some reactions, a single-reactant substrate is broken down into multiple products. ... The enzyme's active site binds to the substrate. Enzymes interact with substrates because substrates fit into the active site of enzymes allowing them to carry out chemical reactions by lowering the EA (energy of activation level). Without substrates we wouldn't be able to do things like digest food.

4 0
4 years ago
Characteristics of flower that pollinated by animal
kotykmax [81]

Pollination can be carried out with the help of wind or animals including insects or birds. Generally these animals feed on nectar in the flower. Animals-pollinated flowers generally have the following features: Brightly colour petals to attract animals.

6 0
3 years ago
Read 2 more answers
How do covalent molecules form?
bazaltina [42]
They form a bond between atoms. covalent<span> compounds are formed only by the interactions of non-metal atoms. hope it helps :)</span>
7 0
4 years ago
Hypothesis Warm-up...PLEASE HELP
mamaluj [8]
4 grams
they die
Thats for 1 and 2

7 0
4 years ago
Other questions:
  • This is the set of rules by which information encoded in genetic material (DNA or mRNA sequences) is translated into proteins (a
    6·2 answers
  • Which organisms are most critical in the nitrogen cycle?
    12·1 answer
  • Methods of microbial control called ________ arrest the growth of microbes.
    11·1 answer
  • What is the growth habit of pecan, peach, water oak, loblolly pine, long leaf pine, and sugar maple trees?
    13·1 answer
  • Which of the following is an example of a gemstone
    15·1 answer
  • What is the basic unit of life​
    7·2 answers
  • Which process does not release water​
    7·2 answers
  • What is Terminator technology
    15·1 answer
  • What is the purpose of a plant cell wall?
    13·1 answer
  • The barrier between the intracellular and extracellular fluid compartments in an animal or plant is the:________
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!