1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
3 years ago
13

Cells within organisms often need to communicate and work together to carry out life's processes. Which of the following enables

cells to communicate?
Biology
1 answer:
LenKa [72]3 years ago
7 0
There are many different ways that cells can connect to each other. The three main ways for cells to connect with each other are: gap junctions, tight junctions, and desmosomes. These types of junctions have different purposes, and are found in different places.
You might be interested in
predict the correct order of the following, from first to last, AND EXPLAIN WHY YOU CHOSE THAT ORDER! - (protein, RNA, traits, D
inysia [295]
DNA, RNA,Protein,Trait

The DNA is transcribed into the RNA during the process 'transcription'. Then, RNA is later translated into proteins during the process 'translation'. Then the protein is turned into traits.
3 0
3 years ago
Which choice best describes the parts of the water cycle? The sun's thermal energy causes water on the earth to evaporate. The w
Travka [436]

Answer:

The sun's thermal energy causes water on the earth to evaporate. The water vapor then condenses and forms precipitation. The precipitation then falls back to the surface of the earth.

Explanation:

<u>The water cycle is an illustration of how water continuously moves or circulates between the atmosphere and the various parts of the earth. </u>

<em>Evaporation of water from the surface of the earth by the thermal energy from the sun causes water to leave the surface of the earth into the atmosphere. When the atmospheric water vapor (humidity) at the upper strata of the atmosphere becomes high, the vapor condenses to form clouds which later forms precipitation that falls back to the surface of the earth.</em>

The ocean's tidal energy does not cause water to cycle on earth.

4 0
3 years ago
Read 2 more answers
What is the scientific name of 'touch me not' plant? can you give an explanation about its mechanism?
lesya692 [45]
<em><u>Scientific Name of Touch-Me-Not Plant is Mimosa Pudica.
</u></em>

The Touch-Me-Not Plant behaves like this because of stimuli. It responds to our sense of touch and curls up.
8 0
3 years ago
Read 2 more answers
Which factors improves soil fertility
lukranit [14]

Answer:

Mineral composition, Soil pH, and Soil Texture

Explanation:

6 0
3 years ago
Read 2 more answers
20 POINTS
brilliants [131]

Answer:

a

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Plz help mee!!(20) points
    12·2 answers
  • In which structure does extracellular chemical digestion of protein begin?
    12·1 answer
  • A cell that is specialized to receive and transmit information is called a(n):
    15·1 answer
  • Why can't humans digest all carbohydrates ?
    11·1 answer
  • Is Suvival SelfishIs Suvival Selfish?
    8·2 answers
  • Question 34 of 34
    15·1 answer
  • How is cancer related to mutations? How is it related to the cell cycle?
    10·2 answers
  • What is the energy source that allows photosynthesis to occur?
    8·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Define matter<br><br> Thanks!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!