1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
10

Why might a bird require more than one habitat ?

Biology
1 answer:
Savatey [412]3 years ago
7 0
Because in winter 1 habitat might get too cold so the bird might have to move to a warmer habitat in winter
You might be interested in
A convergent signal comes from many places to one place true or false?
Studentka2010 [4]
The answer to the question is false that is not true.
6 0
3 years ago
if each triplet of nitrogenous (3 bases in a row, such as GAC) on DNA codes for a specific amino acid how many amino acids will
Charra [1.4K]

Answer: 20

Explanation:

7 0
2 years ago
What is the meaning of adolescent
Pani-rosa [81]
Hey there,
Adolescent means the development of a child into an adult 

Hope this helps :))

~Top
5 0
3 years ago
How does the gasses in earths air differ from place to place
lara [203]
As molten rocks cool gases such as nitrogen water vapor and carbon dioxide are released
5 0
3 years ago
Read 2 more answers
Which statement correctly describes the structure of a centriole
Alex_Xolod [135]
There are no statements given however a centriole is made up of microtubules triplets in a 9+0 pattern (I am unsure of what level of depth is required)
7 0
3 years ago
Read 2 more answers
Other questions:
  • Stable ecosystems can be altered, either rapidly or slowly, through which of the following events?
    6·1 answer
  • ·supports and protects ·
    11·2 answers
  • What change occurs during oxidation?
    15·1 answer
  • Why are many cells wired together in a typical photovoltaic panel
    10·2 answers
  • An organism that reproduces using binary fission, a type of asexual reproduction, creates an identical copy of a cell when
    10·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Isometric exercise strengthens muscles without __________.A.contracting muscle fibersB.changing muscle lengthC.burning caloriesD
    8·1 answer
  • As the human population grows, some minerals in everyday products could
    9·2 answers
  • What happens to the recessive allele in a heterozygous offspring? (for context this question is talking about Gregor Mendel and
    10·1 answer
  • Pretest: Unit 3
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!