1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
3 years ago
8

Please look at the picture and answer ASAP

Biology
2 answers:
nadya68 [22]3 years ago
6 0
It is c but i’m just guessing lol xd
zloy xaker [14]3 years ago
5 0
Not sure but hope you find it!!!
You might be interested in
2. What do geologists mean when they refer to the “grains" that make<br> up a rock?
babymother [125]

Answer:

The scale and arrangement of the minerals or grains that make up a rock are referred to as its texture. Textures of Igneous Rock Compositions and Igneous Rock.

Explanation:

8 0
3 years ago
Which of the following is single-stranded, found throughout the cell, and has the bases A, C, U, and G?
g100num [7]

Answer:

RNA

Explanation:

DNA has the bases of A,T,C, and G.

RNA has the bases of A,U,C, and G.

the T base in DNA is 'Changed' into the base U

4 0
3 years ago
When clotting factors in the plasma are activated to form a blood? clot, the fluid portion of plasma that remains is known as? _
denis-greek [22]

Answer:

When clotting factors in the plasma are activated to form a blood clot, the fluid portion of plasma that remains is known as <u>serum.</u>

Explanation:

The liquid part of blood is known as the plasma. it makes about 90 per cent of the blood and comprises of antibodies and the clotting factors.

If the clotting factors or the fibrinogens are removed from the plasma, then the fluid that remains is termed as serum. The blood serum contains useful proteins like the albumin and antibodies. The serum is the part of the blood that is mostly used for the diagnostic tests.

6 0
3 years ago
Nancy and Paul are designing an experiment to measure the amount of honey produced by each of the bee hives they keep. What shou
AleksandrR [38]
What Paul and Nancy should do to ensure a fair comparison between all the hives is to d<span>ocument the number of bees as compared to the amount of honey per hive.
This is the only fair comparison, because they will know approximately how much each of the groups produced compared to the number of bees.
</span>
8 0
3 years ago
Read 2 more answers
Plants have many différents hormones that inflict their growth
mr_godi [17]

Answer:

yes they have a lot of hormones that affect their growth to develop at a rapid growth to know more study more on genetic

6 0
3 years ago
Read 2 more answers
Other questions:
  • Two factors which cause global climate change are listed below. factor 1: mountain building. factor 2: changes in the amount of
    14·1 answer
  • The ductus arteriosus allows fetal blood to move from the
    7·1 answer
  • What is produced by movement of the liquid outer core of earth?​
    14·2 answers
  • The required reserve ratio is the minimum percentage of​ _____ that​ _____ are required to hold as reserves.
    15·1 answer
  • Which of the following is the function of adult stem cells?
    14·2 answers
  • Transcription is the process by which genetic information encoded in DNA is transferred to
    8·1 answer
  • During the light-independent reactions of photosynthesis, carbon dioxide is combined with hydrogen to form sugars. What is the e
    10·2 answers
  • Sunlight striking the earth at an angle is stronger and hotter than direct sunlight striking earth? True or False
    9·1 answer
  • Is it possible for individual IV-2 to be a carrier? Why?<br><br> Please help!
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!