1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faltersainse [42]
2 years ago
5

Wetland that is often in shallow areas along shores

Biology
2 answers:
kykrilka [37]2 years ago
6 0

Answer:

what's the question though

gladu [14]2 years ago
6 0
The answer: Marsh

Hope this helps
You might be interested in
What idea is Malthus known for?
jenyasd209 [6]
<span>ogy of Human Populations: Thomas MalthusThomas Malthus (1766-1834) has a hallowed place in the history of biology, despite the fact that he and his contemporaries thought of him not as a biologist but as a political economist. Malthus grew up during a time of revolutions and new philosophies about human nature. He chose a conservative path, taking holy orders in 1797, and began to write essays attacking the notion that humans and society could be improved without limits.Population growth vs. the food supply
Malthus’ most famous work, which he published in 1798, was An Essay on the Principle of Population as it affects the Future Improvement of Society. In it, Malthus raised doubts about whether a nation could ever reach a point where laws would no longer be required, and in which everyone lived prosperously and harmoniously. There was, he argued, a built-in agony to human existence, in that the growth of a population will always outrun its ability to feed itself. If every couple raised four children, the population could easily double in twenty-five years, and from then on, it would keep doubling. It would rise not arithmetically—by factors of three, four, five, and so on—but geometrically—by factors of four, eight, and sixteen.<span>
Between 1800 and 2000 the human population increased about six-fold. Has the food supply kept pace? Will there be enough food to support the projected population of 9.2 billion in 2050?</span>If a country’s population did explode this way, Malthus warned that there was no hope that the world’s food supply could keep up. Clearing new land for farming or improving the yields of crops might produce a bigger harvest, but it could only increase arithmetically, not geometrically. Unchecked population growth inevitably brought famine and misery. The only reason that humanity wasn’t already in perpetual famine was because its growth was continually checked by forces such as plagues, infanticide, and simply putting off marriage until middle age. Malthus argued that population growth doomed any efforts to improve the lot of the poor. Extra money would allow the poor to have more children, only hastening the nation’s appointment with famine.A new view of humans
Malthus made his groundbreaking economic arguments by treating human beings in a groundbreaking way. Rather than focusing on the individual, he looked at humans as groups of individuals, all of whom were subject to the same basic laws of behavior. He used the same principles that an ecologist would use studying a population of animals or plants. And indeed, Malthus pointed out that the same forces of fertility and starvation that shaped the human race were also at work on animals and plants. If flies went unchecked in their maggot-making, the world would soon be knee-deep in them. Most flies (and most members of any species you choose) must die without having any offspring. And thus when Darwinadapted Malthus’ ideas to his theory of evolution, it was clear to him that humans must evolve like any other animal.
</span>

7 0
3 years ago
In what part of the cell does protein synthesis occur
Softa [21]
It occurs in the ribosomes.
6 0
3 years ago
A sedimentary rock that is composed of material evaporated from seawater is describe as
ArbitrLikvidat [17]

A rock that is composed of material evaporated from seawater is described as chemical.

3 0
3 years ago
On the Pacific island of Guam, large herbivorous bats called "flying foxes" commonly feed on cycad seeds, a potent source of neu
Bad White [126]

Flying foxes disperse the Cycad seeds if  the seed sometimes get swallowed whole.

Explanation:

  • Cycads are gymnosperms they do not have seeds enclosed in fruit. Therefore the bats are not attracted to cycad fruit.
  • If the bats were susceptible to neurotoxin then they must not have been the frequent feeders of cycad seeds. Biomagnification of neurotoxin in flying fox is a widely researched topic.
  • Beetles do not have an association with these bats thus the bats must not be assisting them as important pollinating agents.
7 0
2 years ago
Samantha has the flu and a high fever. She awoke from a nap damp with sweat. Why was Samantha sweating even though she was not p
RoseWind [281]

Answer:

c her body is attempting to cool itself

Explanation:

6 0
2 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The Florida Everglades are one of the most diverse ecosystems in the United States and are home to many species of birds, reptil
    13·2 answers
  • What feature of alcohol fermentation makes it more suitable for the baking process than lactic acid fermentation?
    10·2 answers
  • The process of making rna from dna
    13·1 answer
  • Which process releases the greatest amount of ATP
    6·1 answer
  • The two waves in the diagram are occupying the same place at the same time
    11·2 answers
  • Science is an attempt to explain
    8·2 answers
  • What is the average speed of a soccer ball that travels 34 m in 2s?
    13·2 answers
  • Which area is likely the oldest crust? <br> 1<br> 2<br> 3<br> 4
    13·2 answers
  • 1. A phospholipid has a head made up of a glycerol molecule attached to a single , which is attached to another small molecule.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!