1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tom [10]
3 years ago
12

Please, help me with this biology question

Biology
1 answer:
krok68 [10]3 years ago
3 0

Answer:

Correct answer is Anaphase

Explanation:

prove me wrong

You might be interested in
Feed a mouse a death cap mushroom. Two hours later, take out its liver and do RNAseq on it. What would you expect the data to sh
kari74 [83]

Answer:

The difference of how you feed a mouse like how much it eats each and every hour

7 0
2 years ago
Complete the table by placing an x in the columns to deacribe each gas. more than one term can be used to describe each gas
olchik [2.2K]

Answer

N

O

C & O

Ar

H & O

Explanation

6 0
3 years ago
What color marble represent the female chromosomes?​
Andre45 [30]

Answer:

it is colour less their is no colour ...

8 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
How many red blood cells does your body make and kill in a seccond?
Andru [333]
 The average red blood cell lives for 120 days.

2. There are 2.5 trillion (give or take) of red blood cells in your body at any moment. To maintain this number, about two and a half million new ones need to be produced every  second by your bone marrow.That's like a new population of the city of Toronto every second.

3. Considering all the tissues and cells in your body, 25 million new cells are being  produced each second.That's a little less than the population of Canada - every second !

4. A red blood cell can circumnavigate your body in under 20 seconds.

5. Nerve Impulses travel at over 400 km/hr (25 mi/hr).

6. A sneeze generates a wind of 166 km/hr (100 mi/hr), and a cough moves out at 100 km/hr(60 mi/hr).

7. Our heart beats around 100,00 times every day.

8. Our blood is on a 60,000-mile journey.


5 0
3 years ago
Other questions:
  • Golgi apparatus non examples
    15·1 answer
  • If you are exposed to the noise of a jack hammer in your work, you are particularly susceptible to a __________ hearing loss. co
    8·1 answer
  • Do you think you can answer this?​
    8·2 answers
  • Abdominal thrusts (also known as the heimlich maneuver) are a method of aiding a
    6·1 answer
  • The marine biome___.
    7·1 answer
  • How is nitrogen important to living organisms?
    9·1 answer
  • A chicken with black feathers (BB) is crossed with a chicken with white feathers (WW). The offspring have black and white feathe
    8·1 answer
  • Which one is better for delivering nutrients to the cells; the open circulatory system or the closed circulatory system? Why?
    13·1 answer
  • All the plants and animals in the world are made of
    14·1 answer
  • A ________________ helps explain observations or events.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!