The probability of two independent events occurring together is the Quotient of the probability of each event occurring separately.
I think the answer would be
A) to transport water and food
Regenerative cells are specific types of cells that can be activated in order to restore organs and tissues back to a pre-existing normal state.
- Stem cells are specific cells capable of generating new specialized types of cells, thereby allowing the regeneration of damaged tissues.
- For example, hematopoietic stem cells can be used to generate new red blood cells whose function is to transport oxygen in the bloodstream.
- Regenerative cells can be used in tissue engineering in order to restore the function and structure of damaged organs.
In conclusion, regenerative cells are specific types of cells that can be activated in order to restore organs and tissues back to a pre-existing normal state.
Learn more about regenerative cells here:
brainly.com/question/1040803
Body parts of unrelated organisms that serve the same function are examples of convergent evolution.
<span>Convergent evolution is the phenomenon when the different species independently create similar features. Those features can be structures that have similar form or function. This happens because organisms have been adapted to similar environments or ecological niches.</span>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
