1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tensa zangetsu [6.8K]
4 years ago
11

Which of the following statements about exponential growth cruves is true

Biology
1 answer:
Butoxors [25]4 years ago
3 0
There is no picture plz add one to be able to help you
You might be interested in
D. Dalmation Dogs may have either black or liver (brown) spots.
kow [346]
A: black spots are dominant
B: ss
C: both parents must be heterozygous to produce an offspring that expresses the recessive trait.
D: SS, Ss, and ss
Hope this helps!
6 0
3 years ago
Explain how the invention of the motor vehicle has been both beneficial and harmful?
natulia [17]
It is harmful because motor vehicles spit out gas and like fumes. That can lead to pollution in the air.

It is beneficial because it helps people get to places they need to get to quicker
8 0
4 years ago
Basic fibroblast growth factor binds to glycosaminoglycans in the extracellular matrix. Which amino acids would you expect to be
WITCHER [35]

Answer:vggvchbhk

Explanation:

3 0
3 years ago
Please help me i’ll give brainlist
k0ka [10]
The answer is a
please mark me brainliest, comment if you need explanation
8 0
3 years ago
How can a florist make long-day plants flower in the greenhouse at a time of year when there are shorter days and longer nights?
rodikova [14]

Answer:

C: Turn on a sunlight imitating light

Explanation:

5 0
3 years ago
Other questions:
  • How does resistance training prevent osteoporosis?
    6·1 answer
  • The double layer of phospholipids is called a?
    14·1 answer
  • Juan picks up a steel utensil and immediately drops it because it’s extremely hot. How does the reflex arc work to protect Juan
    12·2 answers
  • Use tide and tidal range in the same sentence.
    11·2 answers
  • Need help on checking my answers! The ones circled in yellow are the ones that I believe the answers are. Please and thank you (
    8·1 answer
  • MATCH THE DEFINATION!
    7·1 answer
  •  Imagine a change in the iguana's habitat from dry land to aquatic. Based on the Generation I allelic frequencies, we can assum
    10·1 answer
  • Which explains why air masses move?
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What genes are turned on in a nerve cell?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!