1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna [14]
2 years ago
6

Summarize symbiosis.

Biology
1 answer:
Illusion [34]2 years ago
5 0

Answer:

Symbiosis is a close relationship between two species in which at least one species benefits. Mutualism is a symbiotic relationship in which both species benefit. Commensalism is a symbiotic relationship in which one species benefits while the other species is not affected.

You might be interested in
16 - Albinism: Prom Genotype to Phenotype
Mrac [35]

A correct flow chart is DNA i.e., gene (transcription) >> mRNA + tRNAs (translation) >> amino acids or protein >> phenotype.  It is the flow of the genetic information.

<h3>What is the flow of genetic information?</h3>

The flow of genetic information refers to the molecular process from DNA to the final phenotype (i.e., protein product).

During gene transcription, a particular fragment of DNA called gene is used as a template to generate an mRNA.

Subsequently, the mRNA serves as a template to generate a linear chain of amino acids, i.e., a protein, by a process called translation.

The final protein can be considered as the phenotype (in this case, the albinism trait) because it is the observable feature.

Learn more about genetics here:

brainly.com/question/1480756

6 0
2 years ago
1.¿El ciclo del agua tiene un inicio específico?
raketka [301]

Answer:

1)El ciclo del agua no se inicia en un lugar específico, pero para esta explicación asumimos que comienza en los océanos. ... Corrientes ascendentes de aire llevan el vapor a las capas superiores de la atmósfera, donde la menor temperatura causa que el vapor de agua se condense y forme las nubes.

2)El sol, que dirige el ciclo del agua, calienta el agua de los océanos, la cual se evapora hacia el aire como vapor de agua. Corrientes ascendentes de aire llevan el vapor a las capas superiores de la atmósfera, donde la menor temperatura causa que el vapor de agua se condense y forme las nubes.

Explanation:

POR FAVOR REVISAME DE LA MANERA MAS INTELIGENTE BRAINLIEST

7 0
3 years ago
A major feature of the mediterranean diet is liberal intake of
fiasKO [112]
The answer to this question would be: Olive oil

In Mediterranean diet, you need to exchange the butter (since it contains unhealthy fat) with olive oil or canola oil. Saturated fat is also unhealthy so you need to exchange it. Lean meat is good but the consumption must be limited.
3 0
3 years ago
Which fossil type is made from minerals that form stone after the animal decays?
rodikova [14]
<span>Petrified Rock is the answer can you thank me plese i need 2 more</span>
6 0
3 years ago
Which trophic level receives the least amount of energy?
tekilochka [14]

Answer:

Tertiary consumer

6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which letter correctly identifies telophase 1
    13·1 answer
  • Why are scientists able to accurately predict the timing of high and low tides each day of the month
    8·1 answer
  • When washing the dishes, you most likely used an animal from the
    12·2 answers
  • Explain why excess nitrogen in the water can lead to fewer fish and shrimp
    15·1 answer
  • Denumirea pasarilor calatoare
    11·1 answer
  • when cells need energy to do work certain enzymes release the energy stored in the chemical bonds of​
    13·1 answer
  • 1. Some bacteria in the colon help in making vitamin K. What is the
    10·1 answer
  • A) Name the type of cell division that produces cell D from cell B.
    13·1 answer
  • .A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's<br> kinetic energy
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!