1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aev [14]
3 years ago
12

¿cómo será el índice mitótico en un tejido endometrial no canceroso?

Biology
2 answers:
makkiz [27]3 years ago
4 0

Answer:

Entre las posmenopáusicas sin SUA (asintomáticas), hubo 2 casos de cáncer de endometrio, con un grosor endometrial promedio de 10 mm (rango: 5 a 14 mm). En las mujeres postmenopáusicas sin SUA el uso de un valor de corte de 11 mm para el diagnóstico de cáncer de endometrio, mostró baja sensibilidad (Tabla V).

stepan [7]3 years ago
3 0

Answer:

please I don't know

Explanation:

please I don't understand

mbok nkopo se seem ado

You might be interested in
Pls help again, brainlist!!!!!!!!!!!!!!!!!
Vlad1618 [11]

Answer:

Inside the air sacs, oxygen moves across paper-thin walls to tiny blood vessels called capillaries and into your blood. A protein called haemoglobin in the red blood cells then carries the oxygen around your body.

Explanation:

hope it will help you

7 0
2 years ago
The net energy yield from this pathway, where glucose is broken down through several steps forming pyruvate, is ________ molecul
stepan [7]

Answer:

2 molecules of ATP and 2 molecules of NADH

Explanation:

Glycolysis is the first step of cellular respiration (break down of glucose to extract energy) which occurs in the cytoplasm. Glycolysis is a pathway common to all living organisms- prokaryotes and eukaryotes, as it does not require oxygen to occur.

Glycolysis occurs in two major phases (ten steps) requiring 10 enzymes catalyzing each step; the energy-requiring phase and the energy-requiring phase.

In the energy-requiring phase, the starting molecule (glucose) gets rearranged in a series of chemical reactions, and two phosphate groups gets attached to it producing fructose-1,6-bisphosphate which is unstable, This modified sugar then splits in half due to its instability to form two different but inter-convertible phosphate-bearing three-carbon sugars (Dihydroxyacetonephosphate, DHAP and Glyceraldehyde-3-phosphate, G3P). Because the phosphates used in these steps come from 2 ATP molecules, 2 ATP molecules get used up in this phase

All the DHAP molecules get converted to G-3-P in order to enter the next phase.

In the energy-recovering phase, the 3-carbon sugar (G3P) is converted into another three-carbon molecule called pyruvate, through a series of reactions. In these reactions, two ATP and 1 NADH molecules are made. This recovery phase occurs twice (one for each of the two isomeric three-carbon sugars, DHAP and G3P). Hence, a total of 4 ATP and 2 NADH molecules are produced in this phase.

Overall, Glycolysis converts one glucose (six-carbon) molecule to two pyruvate (three-carbon) molecules and a net release of 2 ATP molecules (4 overall - 2 used) and 2 NADH molecules.

3 0
3 years ago
How can volcanic eruptions cause the average temperature on the planet to drop?
steposvetlana [31]
The ash in the atmosphere blocks the sunlight.

Hope this helps! <3
3 0
4 years ago
What is most likely to happen during deposition?
slamgirl [31]
The creation of a new life-growing area. such as a forest or new land. Deposition means when something breaks down and is carried to another location. Hoped that helped.
7 0
4 years ago
Read 2 more answers
Which one is the true answer
AnnZ [28]
Diego. Correct me if wrong
8 0
3 years ago
Other questions:
  • A scientific observation is different from a inference. An inference involves a degree of probability that an scientific observa
    12·1 answer
  • If the tasmanian devil has ______, then it is a boy. If the tasmanian devil
    11·1 answer
  • Which is a function of protein macromolecules?​
    6·2 answers
  • A type of advantage that a global company possesses by virtue of the fact that it has experience in more than one country is ref
    5·1 answer
  • PLS HURRY I NEED IT ASAP What is fenton's procedure pleas describe
    9·1 answer
  • Why is a virus considered to be nonliving(info provided in text of reading)?​
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • A homogeneous mixture is known as a(n) A dicolloidal B solution C solvent D suspension​
    6·2 answers
  • Why does diuron cause coral to bleach
    6·1 answer
  • Which of the following accurately describes the use of fossil fuels for energy?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!