Explanation:
All cells have a plasma membrane, ribosomes,and DNA. The plasma membrane, or cell membrane, is the phospholipid layer that surrounds the cell and protects it from the outside environment. They both use ribosomes for producing proteins.
+sorry i made a mistake on the previous question. Prokaryotic cell doesn't have nucleus. I obviously didn't know the right meaning of this word bc im not a native english speaker
1.) plasma
2.) Blood brings oxygen and nutrients to all the parts of the body so they can keep working.
3.)no
If you are operating your powerboat near a shoreline, what's important for you to do if you want to help prevent erosion is maintain wake speed to avoid swerving in a counter-clockwise direction. This means that you will run the boat at the slowest possible speed if you want to avoid erosion of soil on the shoreline.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
It is Isotonic to the fish egg solution
Explanation:
It is Isotonic because Isotonic is a solution that has the same solute concentration with another solution I.e the amount of solute in one solution is the same with the other. This slow the free flow of solutes in equal part through the semipermeable membrane from one solution to the other.
