1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
noname [10]
3 years ago
13

Which type of organisms do photosynthesis?

Biology
2 answers:
BlackZzzverrR [31]3 years ago
8 0

Answer:

producers

Explanation:

hope this helps

brilliants [131]3 years ago
5 0

Answer: Plants, algae, and a group of bacteria called cyanobacteria are the only organisms capable of performing photosynthesis.

Explanation: Because they use light to manufacture their own food, they are called photoautotrophs (literally, “self-feeders using light”).

You might be interested in
Are viral infections curable? Why or why not?
Anna11 [10]

Answer:

no.

Explanation:

Viruses, on the other hand, are not cellular. We can't kill them simply by disrupting their cells. They are infective nucleic acids which cannot replicate outside of living cells. They must invade a human cell to reproduce, because they cannot produce energy or synthesize molecules on their own. Some viruses replicate inside human cells and then bud off from the human cell inside an "envelope" made from the human cell's own membrane, which helps them evade the immune system on their way to infecting another human cell. Many viruses are protected by protein capsids, which are extremely protective--unlike a bacterial cell wall or membrane, the virus doesn't have to be alive inside the capsid or exchange nutrients and waste with the environment across the capsid; the capsid is merely there to protect the nucleic acid of the virus.

Viruses need to match some sort of receptor in order to gain entry into human cells, and in some viruses, this receptor is one of the few good targets for drug therapy; however, unlike antibacterials, the drug will only work for that particular virus/receptor, because each virus uses a different receptor.

Viruses spend time inside human cells, which protects any outer antigens from some of the aspects of the immune system. There are times when viruses are especially vulnerable during replication, but there are reasons they are harder than bacteria to target with these antireplication drugs: 1) unlike for most bacteria, the drugs need to be small enough to enter the human cell where the virus is replicating, 2) unlike for most bacteria, the drugs can't simply target a protein shared by most viruses; furthermore, many viruses hijack human proteins which cannot be targeted. Overall, there are comparatively few antiviral drugs compared to antibiotics because of the huge difficulty in obtaining selective toxicity. And 3) most drugs available target a certain step of viral replication for a certain family of viruses; however, by the time the patient shows symptoms, the virus has already created countless copies of itself or become latent in human cells, and at that point it is too late for most of the antiviral drugs to be super helpful since they target the replication itself. Even when a good antiviral drug is developed, most of them work only against a single species (or at best, a family) of viruses, which is not the case for most antibiotics.

Many viruses don't spread in ways where they can easily targeted (Polio moves from the GI tract to lymph nodes and then to the blood stream on it's way to the spinal cord to cause paralysis; it is vulnerable to the immune system in vaccinated individuals while it is forced to travel in the blood. In contrast, some viruses like rabies, herpes, and varicella-zoster spread through neurons in order to evade the immune system. Other viruses form syncytia because they travel directly from cell to cell). Also remember that some viruses integrate themselves into human DNA and remain latent for long periods of time, which prevents them from being cleared by drugs or the immune system. The human immune system does have its ways of dealing with viruses, which I can get into in greater detail in another post. For certain viruses, the only way we have to treat them is to use interferons to ramp up the immune system (a very unpleasant therapy which must often be maintained for very long periods of time).

One of the reasons that vaccines for some viruses are not effective is that oftentimes, a live (attenuated) vaccine cannot be made for those certain viruses since the reversion mutation rate is too high to provide an acceptable risk; for many viruses, only killed strains can be used, if at all. Without a live attenuated virus strain multiplying inside cells, certain critical aspects of the immune system are not activated against these certain viruses. In cases where killed viruses are able to be used as vaccines, the protection is lesser (for instance, no type-switching to IgA antibodies which would be more effective than IgM) and shorter-lived.

7 0
3 years ago
Read 2 more answers
I need help please i don’t understand
Oxana [17]
The answer is the first one ( it has more protons than electrons)
6 0
2 years ago
HELP PLS NOW LOOK AT MY PROFILE FOR MORE QUESTIONS
eduard

Answer:

Im pretty sure its A :)

Explanation:

deoxyribose

​Nucleotide

A nucleotide consists of a sugar molecule (either ribose in RNA or deoxyribose in DNA) attached to a phosphate group and a nitrogen-containing base.

ribose

The five-carbon sugar in DNA is called deoxyribose, while in RNA, the sugar is ribose.

4 0
3 years ago
How is the majority of energy within an ecosystem lost?
Alekssandra [29.7K]

Answer:

idekoifoiwhwoifh

Explanation:

6 0
3 years ago
The following statements pertain to the development of the theory of the structure of DNA. Match the statement with the appropri
Mila [183]

Answer:

The correct answer will be-

1. Observation-option B.

2. Hypothesis-option A.

3. Experiments- option C.

Explanation:

A scientific method involves various steps to explain a natural phenomenon of nature. It begins with making an observation which leads to asking the scientific question. The researcher does background research and proposes a hypothesis which could be tested through experiments. The experiments could prove or disprove the hypothesis based on the results.

In the given question the observation made is an equal amount of A and T and G and C are observed. It leads to a hypothesis which shows that this could have happened due to the winding of two strands of DNA and the experiments was performed through X-ray diffraction pattern.

Thus, the selected options are the correct answer.

5 0
3 years ago
Other questions:
  • 24. Why Is ATP an important molecule for cells?
    10·1 answer
  • A woman gives birth to a small infant with a malformed skull. the infant grows abnormally slow and shows signs of substantial co
    15·1 answer
  • Convection currents or wind in the atmosphere ____.
    8·2 answers
  • If grey fur is dominant to white fur in a rabbit population, how many possible phenotypes will there be in the offspring of a cr
    12·1 answer
  • The products of photosynthesis are carbohydrates and oxygen. Which process uses these substances as reactants ?
    8·2 answers
  • How did you determine whether items in the pond water were living or nonliving?
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • PLEASE HELP ASAP!!! I WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!
    14·1 answer
  • 23) What is the function of the pancreas?
    5·1 answer
  • Climate is defined by all of the following except for:________.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!