1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolbaska11 [484]
2 years ago
5

Disadvantage of using common names such pangolin or scally anteater

Biology
1 answer:
omeli [17]2 years ago
5 0

Answer:

confusion

Explanation:

it may confuse or mess up the data collected on a research

You might be interested in
The Doppler effect indicates that the universe is expanding because_____
zimovet [89]
Your answer should be B
4 0
3 years ago
Read 2 more answers
A star is not considered born until the process of nuclear fusion
jonny [76]
Star is a brilliantly glowing sphere of hot gas whose energyis produced by an internalnuclear fusion process. Stars are contained in galaxies. A galaxy contains not only stars, but clouds of gas and dust. These clouds are callednebulae, and it is in a nebula where stars are born. In the nebula is hydrogen gas which is pulled together by gravityand starts to spin faster. Over millions of years, more hydrogen gas is pulled into the spinning cloud. The collisions which occur between the hydrogen atoms starts to heat the gas in the cloud. Once the temperature reaches 15,000,000 degrees Celsius, nuclear fusion takes place in the center, or core, of the cloud. The tremendous heat given off by the nuclear fusion process causes the gas to glow creating a protostar. This is the first step in the evolution of a star. The glowing protostar continues to accumulate mass. The amount of mass it can accumulate is determined by the amount ofmatter available in the nebula. Once its mass is stabilized, the star is known as a main sequence star. The new star will continue to glow for millions or even billions of years. As it glows, hydrogen is converted into helium in the core by nuclear fusion. The core starts to become unstable and it starts to contract. The outer shell of the star, which is still mostly hydrogen, starts to expand. As it expands, it cools and starts to glow red. The star has now reached the red giant phase. It is red because it is cooler than the protostar phase and it is a giant because the outer shell has expanded outward. All stars evolve the same way up to the red giant phase. The amount of mass a star has determines which of the following life cycle paths the star will take.
4 0
4 years ago
Rattlesnakes have thermoreceptors on the front of their faces called _____ organs, which allow them to detect infrared radiation
inn [45]

the answer to this question is pits

8 0
3 years ago
Read 2 more answers
Write the common food chain of a pond ecosystem.​
kozerog [31]

Explanation:

In a freshwater aquatic ecosystem like a pond, the organisms in the food chain include algae, small animals, insects and their larvae, small fish, big fish and a fish-eating bird or animal

pls mark brainliest

6 0
3 years ago
Read 2 more answers
Looking at this barometer is the air pressure high or low? What type of weather would you expect?
igomit [66]

Answer:

i think ti would be D. sorry if it's wrong.

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Brown eyes are dominant over blue eyes. cross two blue-eyed individuals. what eye color will the offspring have?
    13·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • how is the loss of a keystone species from an ecosystem similar to and different from the loss of an indicator species
    13·1 answer
  • List five ways water is important to you in your daily life.
    10·2 answers
  • I forgot the question
    13·1 answer
  • The life history pattern in which population growth is logistic is called
    14·1 answer
  • Which of these statements about molecules is true? A. All molecules only contain one element
    5·1 answer
  • If the gametes produced by a given organism contain 6 chromosomes, how many chromosomes are found in that organism’s body cells?
    14·1 answer
  • Can someone pick one of these and do it for me I give brainless (EMERGENCY it’s due in 30 mins) please!!!!
    5·1 answer
  • Explain why interactions between organisms are important.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!